Fig. 5

DNA binding and transcriptional repression activity of EgMYB4. a Schematic diagram of the EgF5H and EgCOMT promoter. The blue triangles represent AC-IV elements. The orange triangles represent AC-V elements. b DNA binding ability of EgMYB4 analyzed by electrophoretic mobility shift assay. The recombinant EgMYB4 protein can bind to the AC-IV sequence GAGGCCCATAAACCAAACGTAGAAAAG and AC-V sequence GTTATCCGTTCGCAACAACCCGCCATATCAACCAAG but not to the mutant AC-mIV sequence GAGGCCCATAAGAAGGGAGTAGAAAAG or AC-mV sequence GTTATCCGTTCGCGGAGGATCGCCATATCAACCAAG. Competition experiments were performed using unlabeled AC-IV and AC-V probes as competitors in a 250-fold molar excess. c Effectors and reporters used in this study. EgF5H promoter activity in EgMYB4-YFP expressing leaves and YFP expressing leaves was measured by GUS staining (d) and GUS quantification (f). EgCOMT promoter activity in EgMYB4-YFP expressing leaves and YFP expressing leaves was measured by GUS staining (e) and GUS quantification (g). Values are means ± SE (n = 8). Asterisks indicate significant differences in GUS activities between different treatments (**, p < 0.01; Student’s t-test)