Skip to main content

Table 2 Names, sequences, and references of primers used in this study

From: Phylogeny and maternal donors of Elytrigia Desv. sensu lato (Triticeae; Poaceae) inferred from nuclear internal-transcribed spacer and trnL-F sequences

Gene Name of primers Sequence of primer (5′- 3′) Reference
nrITS ITS4 TCCTCCGCTTATTGATATGC Hsiao et al. (1995) [59]
ITS-L TCGTAACAAGGTTTCCGTAGGTG  
trnL-F C CGAAATCGGTAGACGCTACG Mason-Gamer et al. (2002) [44]
F ATTTGAACTGGTGACACGAG