Skip to main content

Table 2 List of qRT-PCR primers

From: Genome-wide analysis of wheat calcium ATPases and potential role of selected ACAs and ECAs in calcium stress

Primer pairs Primers Sequence (5′ - 3′)
1 TaECA1-F CAGTTTCAATGAATGGCTTTTGGTC
TaECA1-R CTTTCTGGCCCGAGCTGTCA
2 TaECA3-F TCTCTACTTGTCATTCACCCATGG
TaECA3-R ATGGAGACACTGAGAAAAGAGCT
3 TaACA2-F CGTCTTCTGCCAGGTGTTCA
TaACA2-R GCCGAGGAATTGGACCATGA
4 TaACA3-F AGGGCATGTTGGAGAACTCT
TaACA3-R GCCAAAGAGGATGCAGACGA
5 TaACA4-F GCTGGCAATTCTGGTTGGTG
TaACA4-R TATGTCATCAGGGCCGTTGG
6 Actin-F ACCTTCAGTTGCCCAGCAAT
Actin-R CAGAGTCGAGCACAATACCAGTTG
\