Skip to main content

Table 2 Novel miRNA-target pairs in barley based on the degradome data sets

From: microRNAs participate in gene expression regulation and phytohormone cross-talk in barley embryo during seed development and germination

miRNA Sequencing cDNA_ID Target annotation miRU
start-ending
PARE_cutsites
novel-mir-119 TCTTGACCTTGCAAGACCTTT AK362090 ARF 3 1362–1382 1373
  AK369226 ARF 3 423–443 434
novel-mir-400 CGACGAGTCGGACGCGTCGAGCA MLOC_53497.2 Predicted protein 587–609 600/733
novel-mir-205 TCACAGATAATGGTGGCCCCTG MLOC_54213.1 Predicted protein 389–410 401