microRNAs participate in gene expression regulation and phytohormone cross-talk in barley embryo during seed development and germination

Table 2 Novel miRNA-target pairs in barley based on the degradome data sets

miRNA	Sequencing	cDNA_ID	Target annotation	miRU start-ending	PARE_cutsites
novel-mir-119	TCTTGACCTTGCAAGACCTTT	AK362090	ARF 3	1362–1382	1373
novel-mir-119		AK369226	ARF 3	423–443	434
novel-mir-400	CGACGAGTCGGACGCGTCGAGCA	MLOC_53497.2	Predicted protein	587–609	600/733
novel-mir-205	TCACAGATAATGGTGGCCCCTG	MLOC_54213.1	Predicted protein	389–410	401

ISSN: 1471-2229