Skip to main content

Table 3 Tags identifying antisense sequences

From: Deep Super-SAGE transcriptomic analysis of cold acclimation in lentil (Lens culinaris Medik.)

TAG number TAG sequence Fold change1 Nucleotide sequence identity between TAG and lentil sequences2 Lens sequences Other legume species sequences UniProt identification and accession number
AS8 CATGAGATTGCACTTGAGTAACTTGG
ANTISENSE
7.34 25-26 64544 647
331115122
502080648
2 g104400
Mediator of RNA polymerase II transcription subunit 15a??
Transcription cofactor, putative, G7IM96_MEDTR??
AS27 CATGAGTTGGCGTCCAATATTTTGAA
ANTISENSE
5.67 25-26 72001 296
56138 122
331117328
086s0008
502127601
ABC transporter C family member??
NAS10a CATGTTTTTGAATTGTGATTGCTCTC
ANTISENSE
7.28 25 N107087
N6881
331108837
368545933
388509589
502117510
571480914
Haloacid dehalogenase-like hydrolase, A0A072VYK9_MEDTR
NAT38 CATGATTTTCCCTCTCAAGACTAAGT
ANTISENSE
5.10 25-26 N11063
68382 215
66867 237
552990588
502124263
571537824
Protein FAM135B-like protein, A0A0B2PEB3_GLYSO
NAT39 CATGGTCATAAAGGTTCTGAATAGGG
ANTISENSE
See AS2 and AT7
5.10 25-26 331108296
268537762
268541446
5g097280
502099852
359806052
Light-harvesting complex I chlorophyll A/B-binding protein, G7KEN2_MEDTR
Chlorophyll a/b binding protein 215, CB215_PEA
N15 = T30 CATGATGTCGCCGACCGTAACAATAA
ANTISENSE
5.08 25-26 331109463
87696 239
64868 288
1g012710
1g012690
502124985
Protease inhibitor/seed storage/LTP family protein, G7I725_MEDTR
A18 = T25 CATGGTTATAGCCTCCTCCTCCACCA
ANTISENSE
See A1, A22 and A35
5.39 26 331121144
65367 194
5g084570
114415397
502097761
Cold and drought-regulated protein CORA, G7K7D2_MEDTR
Putative glycine-rich protein, Q0E7L3_PEA
A25 = T26 CATGATGATATAATCAGTTACCATTG
ANTISENSE
5.01 23-26 65697 176
331109145
2605888 Dormancy-associated protein, O22612_PEA (glycine-rich protein).
A35 CATGGCCAATAGGCCAAGGATGAGGA
ANTISENSE
See A1, A18 and A22
4.04 26 C1949
331121144
331108748
5g084570
114415397
Putative glycine-rich protein, Q0E7L3_PEA
Cold and drought-regulated protein CORA, CORA_MEDSA
G7K7D2_MEDTR
  1. 1 The 0 normalized values were changed to 0.5 to calculate fold change
  2. 2 Two numbers indicate the existence of polymorphism among lentil sequences in the nucleotide sequence corresponding to the TAG