Skip to main content

Table 5 Four SNP loci significantly related to protein content as determined by genome-wide association analysis

From: Diversity analysis of cotton (Gossypium hirsutum L.) germplasm using the CottonSNP63K Array

SNP Significance test p-value Genome sequence Chromosome Position
Marker i28873Gh Wald test 3.70E-06 G. raimondii v221 * 0
Group TAMU Likelihood Ratio Test 1.11E-05 G. arboreum v2 Ca13 41,692,946
Group_name GH_TBb049I03r236 Score Test 4.81E-05 G. hirsutum NBI v1.1 NBI_A02 7,820,104
Sequence TCGATATGAACGGAAAATGCTTGCTCGTCGGTTGGAAGGGGACGCCGATGYTTTCAATTTCGGTTTGGAA
ATTTCTATAAGCCAATGTCTAAATGTTACCA
Marker i34975Gh Wald test 3.70E-06 G. raimondii v221 Chr05 7,028,098
Group TAMU Likelihood Ratio Test 1.11E-05 G. arboreum v2 Ca13 41,671,786
Group_name GH_TBb119J20f639 Score Test 4.81E-05 G. hirsutum NBI v1.1 NBI_A02 7,800,710
Sequence ATGGATGACAGAAATAGGACTATGATCAATCCCATCCACCGCTACTCGGTMCCTGTGTATCCAGGTACC
CAACACAAAGCTAGCTAGCTATGACAGTAAAT
Marker i20295Gh Wald test 1.52E-05 G. raimondii v221 Chr13 30,556,525
Group CSIRO Likelihood Ratio Test 9.78E-04 G. arboreum v2 * 0
Group_name Scaffold_13_30556525 Score Test 6.41E-03 G. hirsutum NBI v1.1 * 0
Sequence AACGTACTAAATTCGTAGTTAGATAGTAGCCAAGGACTCACTTAAACCAACTAAAACATCAACCTATTCTAAGTTCTCATGTAACAAAAATTTAACATAAYAAACTTAGAATGCTTATAACTCGGTCTATGCTTAACCTTTTCACCTAAAACGAATTTTGTTCACCTATTTAGTCTTCTACGACTAATCATCAACCCTTAA
Marker i22490Gh Wald test 1.60E-05 G. raimondii v221 * 0
Group USDA Likelihood Ratio Test 1.03E-03 G. arboreum v2 * 0
Group_name CFB2569 Score Test 6.41E-03 G. hirsutum NBI v1.1 NBI_D01 35,251,544
Sequence TGCCGCATACTTGTGGACCACATARTCGTGTACAATTGGAAAATTAGGGATTTAGAGGAATTTTGGTGCC
ACACGACCGTGTGGCTGATT
  1. Information is provided on p-values associated with three significance tests, as well as known chromosomal locations in three available Gossypium genome sequences