Skip to main content

Table 1 Real-time PCR primers for genes expressions detection

From: Exogenous spermidine improves seed germination of sweet corn via involvement in phytohormone interactions, H2O2 and relevant gene expression

Gene name Accession no. Primer sequence
18s rRNA NC_008332.1 F: 5′- ACATGCGCCTAAGGAGAAATAG -3′
R: 5′- ACCTCCATGCTCACTGGTACTT -3′
ZmADC1 NM001323076 F: 5′- GCTACGGCTCAAGGTACCAG-3′
R: 5′- CCGAACTCCACAATGTCCTC-3′
ZmODC NM 001148682 F: 5′- GCGCCTACTCCACAGGTTC -3′
R: 5′- CGTAGATCTTAATCTCCGACGTG-3′
ZmSPDS NM 001155838 F: 5′- TGTTCAATTCCATCCCCTAAA -3′
R: 5′- TCCACTGAACTGTGTCTGGAA-3′
ZmSAMDC2 NM 001112243 F: 5′- TGTGGCTACTCCATGAATGC-3′
R: 5′- CGTAACTGGCGTAGCTGAAA-3′
ZmSPMS AY730048 F: 5′- ATCCTCGTGTCCGACTTCA-3′
R: 5′- CATCATATTTTCCTTCAGGGAGA-3′
ZmGA3ox1 NM 001279524 F: 5′- CACCATGCATCTCAACTGGTA-3′
R: 5′- GAAGGTGAAGAAGCCCGAGT -3′
ZmGA20ox4 NM 001156050 F: 5′- GAGAGGTTCTCCATGCCCTA-3′
R: 5′- AAGAAGTCGCCCCAGTTGTA -3′
ZmGA2ox NM 001158585 F: 5′- GAGAGGTGTGGGTTCAGGTG -3′
R: 5′- CGAGCTTGCAATTACCCTGT -3′
ZmNCED1 XM 008672757 F: 5′- GCACCGTGGAGAAGTTCG -3′
R: 5′- ACAGCACGTACCCGTCATC -3′
ZmZEP NM 001157971 F: 5′- CAGCACGGCATAACACCTC -3′
R: 5′- GCGAAAGAGAAGACGTTGGA-3′
ZmAAO NM 001111838 F: 5′- CTGGAATATCACCAGATGTGAGTC-3′
R: 5′- TGCCCCAGTTGTACTTTTTGA-3′
ZmACS NM 001152929 F: 5′- GACGCCTTATTACCCAGCTTT -3′
R: 5′- ATGGGCAGCAGCTTCACT -3′
ZmACO1 NM 001136755 F: 5′- ACCGCTACAGGCAGGTGAT -3′
R: 5′- CTCCAGGCCCAGGTTCTC -3′