Skip to main content

Table 1 Primers used for qPT-PCR assays

From: Nitric oxide is involved in hydrogen gas-induced cell cycle activation during adventitious root formation in cucumber

Gene Accession no. Primer pairs
CycA EW968279 F: 5′- GCCTCTGCTGTAACAACACTCAT-3′
R: 5′- TGTGCTGGCTGTATTTTTCTCTG -3′
CycB EW968280 F: 5′- AATGAGGGCTATTTTGGTGGA-3′
R: 5′- TATCCGAAAGGCACACAAAGTC-3′
CDKA EW968281 F: 5′- ATCTAAAACCCCAAAATCTGCT-3′
R: 5′- CAAATGCTCTTGCCAGTCC -3′
CDKB EW968282 F: 5′-CAATCCCTCTATGTCGTTCG-3′
R: 5′- CAAATGCTCTTGCCAGTCC-3′
CsDNAJ-1 X67695 F: 5′- GACCACTCTCCACGATGTCAAC-3′
R: 5′- ATCAATGTGTTATGGCGGTAGC-3′
CDPK1 AJ312239 F: 5′- GGAGTTGGAAGGAGGACGATG-3′
R: 5′- TGAGATTTAGCAGTAAGGACGC-3′
CDPK5 AY02785 F: 5′- ATGAGGAAAGGCAATCAGGAAT-3′
R: 5′- AAAGAAGCACATAAAATCAAGCAGA
actin DQ641117 F: 5′-CCCATCTATGAGGGTTACGCC-3′
R: 5′-TGAGAGCATCAGTAAGGTCACGA-3′