Skip to main content

Table 1 Novel miRNAs abundance identified by small RNA libraries

From: microRNA-dependent gene regulatory networks in maize leaf senescence

novel miRNA Length (nt) sequence (5’--3’) ELS-1 20DAP ELS-1 30DAP Yu87-1 20DAP Yu87-1 30DAP
Predict-miR-1 21 CAGTGCATCCAAACAAGACCT 1.16 0.00 0.54 0.00
Predict-miR-2 22 GGAAATAATTTCTGATGACATA 0.00 0.00 1.63 2.26
Predict-miR-3 21 ATTAGGCTCGGGGACTATGGT 0.00 0.88 22.61 12.19
Predict-miR-4 22 TCTGTTTGGTTTTAGGGACTAA 1.54 0.00 3.08 0.00
Predict-miR-5 21 TCACTATCGCCGAATCTCGAA 1.93 0.00 0.54 0.00
Predict-miR-6 21 AAGTGCAGCCAAACAAGACCT 1.16 0.00 0.54 0.00
Predict-miR-7 22 ACTGGAATCCAACGGTCAGGAG 0.00 3.82 4.52 6.78
Predict-miR-8 21 TTTTAGCCCCTCCAATCTCCC 2.31 1.47 4.34 3.16
Predict-miR-9 23 TTCGAATTTCTGTCTATAATGCA 104.53 0.00 0.00 31.16
Predict-miR-10 21 CACTACAGATGAGACTAGGAG 1.93 1.18 0.00 0.00
Predict-miR-11 21 CGTCTTGTTTTTACTCCTATG 8.10 15.29 0.00 3.16
Predict-miR-12 21 GGGATTGGAGGAGCTAAAATC 0.00 0.29 0.72 0.00
Predict-miR-13 22 GAGGGACTAAAGACTAAAATAG 0.00 2.94 0.00 9.03
Predict-miR-14 21 GAGTTGATCTAGGTAATTATT 3.09 1.77 0.00 0.00
Predict-miR-15 23 TGCAGTAACGACAGTCAGAGCAG 0.00 0.00 1.99 1.36
Predict-miR-16 21 AAATACATTTTTAGGCCCTTG 0.00 0.88 0.00 3.61
Predict-miR-17 21 GTGAGAGAAGGGTATAATCAC 0.00 0.88 0.00 2.71
Predict-miR-18 22 CTTGGTAAAGTGACTCAACGTG 1.93 1.77 0.00 0.00
Predict-miR-19 21 GTATCCTTGTTCCCAAACAAG 0.00 1.18 2.89 0.00
Predict-miR-20 22 GATGGTTAACTGATGTACTCCA 0.00 0.00 0.54 2.26
Predict-miR-21 21 TAACGGGTAGAGAATCTTCTC 13.89 16.18 0.00 14.00
Predict-miR-22 20 CTTGAAGAGCAGCTAGGTCA 24.30 0.00 0.00 11.74
Predict-miR-23 20 TAGGTTAAGGCCTCGTTCGT 5.40 6.77 1.45 0.00
Predict-miR-24 23 AAATAATTTTTGATGACATACAG 0.00 0.00 1.63 2.26
Predict-miR-25 20 GCGAGAATGACGAAGAAAAT 0.00 0.00 2.53 9.03
Predict-miR-26 21 TAGTGATGCTATCAAGAATCA 0.39 0.29 0.00 0.00
Predict-miR-27 21 GTGATTATACCCTTCTCTCAC 0.00 0.88 0.00 1.81
Predict-miR-28 21 TTTTAGCCCCTCCAATCTCCT 0.00 0.00 4.34 3.61
Predict-miR-29 21 TGGTTCGTTGGATCTAGATTT 0.00 0.88 1.27 0.00
Predict-miR-30 21 ATGTAATTGAGACCCAAACAT 0.00 0.88 0.54 0.00
Predict-miR-31 21 TGGATTTTGATTGGATACATC 0.00 0.00 5.79 1.81
Predict-miR-32 20 AGCTGGAATAGCTCAGTTGG 46.29 23.53 3.26 9.49
Predict-miR-33 21 GGCATGCAAGTTCTCTAGCTA 0.00 1.18 1.63 0.00
Predict-miR-34 23 TCAGTCTGCCTTCTGTCTTTGAC 1.16 2.06 0.00 0.00
Predict-miR-35 21 CAAGGGCCTAAAAATGTATTT 0.00 0.88 0.00 3.61
Predict-miR-36 20 TGGTTCCCACTCATGACCCA 33.94 63.83 10.31 21.68
Predict-miR-37 21 AAGAGGATTGAAGGGACTAA 0.00 0.00 1.27 1.81
Predict-miR-38 22 TTCTTGTTTGGATATTTAGCTC 0.00 0.88 1.81 1.81
Predict-miR-39 21 ATGTGATTATACCCTTCTCTC 0.00 0.88 0.00 1.36
Predict-miR-40 21 TTATTCTGACATTTTGTTCTA 0.00 0.00 2.35 1.81
Predict-miR-41 21 GAGTTGATCTAGGTAACTAGT 2.31 1.77 0.00 0.00
Predict-miR-42 21 GAGCTCACCGGAACACCTCAT 0.00 0.00 0.72 1.36
Predict-miR-43 20 TTAAAGCTATATCATCACAT 0.00 2.06 0.00 1.81
Predict-miR-44 21 TGTTCGGTTGTGTGTGGATCG 1.93 0.00 2.71 8.58
Predict-miR-45 21 TTGTTAATGTTTGGAGTAGCG 11.96 0.00 0.00 6.78
Predict-miR-46 23 TGCCTCAGATGGACGCTTTGGAA 7.33 7.65 5.43 7.23
Predict-miR-47 23 TTCGAATTTTTGTCTATAATGCA 83.70 0.00 0.00 27.10
Predict-miR-48 22 TATGTATGGTCATGGTTGATGT 3.47 4.41 0.00 0.00
Predict-miR-49 21 GTTGGATTTTGTTTGGATGCA 0.00 0.00 5.07 1.81
Predict-miR-50 21 GAAACTGGTTTTTGCTGACAT 9.64 3.24 4.88 7.23
Predict-miR-51 21 TGCATCCAAACAAAATCCAAC 0.00 0.00 5.07 1.81
Predict-miR-52 22 CGGGCATGATAGACCAAGTCTA 10.80 0.00 0.00 11.29
Predict-miR-53 20 TGGGTCATGAGTGGGAACCA 33.94 63.83 10.31 21.68
Predict-miR-54 21 ATTTTAGCCTCTTCAATCCTC 0.00 0.00 34.73 29.81
Predict-miR-55 23 GCTAAAGTATATCAGGTCAAGGA 1.93 4.71 3.26 4.07
Predict-miR-56 21 CTACTTCCTTCGTTCCATAAA 0.00 0.00 0.91 3.16
Predict-miR-57 21 ATGCAGACGCAACCGAACAAG 0.77 0.00 0.18 0.00
Predict-miR-58 23 TGCTCAGCAGTCAGTAAGTCAGT 3.86 3.24 2.17 4.52
Predict-miR-59 23 TTCACTGTCAGAGATCTTCACGG 9.26 5.00 6.15 0.00
Predict-miR-60 21 GTCAATACTAGAGAATCCAAA 0.00 0.00 2.71 1.36
Predict-miR-61 21 ACTAGATTGGAGGGGCTAAAA 1.93 0.00 0.00 3.16
Predict-miR-62 21 CTGTTGGCTACCGTCGTCGAG 3.09 2.35 0.91 0.00
Predict-miR-63 23 TCCGGGCTTGTTTCGTAGAAATC 1.54 1.77 0.00 0.00
Predict-miR-64 21 AGTTAGATTTTGATTAGATGC 1.54 0.00 0.72 0.00
Predict-miR-65 21 GTCTGTAAATTGTTCTGCATA 27.39 19.12 38.35 31.16
Predict-miR-66 22 AGAGATTGTTATTTATAATGTT 0.00 0.00 1.63 1.36
Predict-miR-67 21 GCTCTCTCTGGTTCTCCCGAT 3.86 3.53 0.00 0.00
Predict-miR-68 20 AAGTTTAGGGATTTTTGGAG 1.54 0.00 0.00 7.68
Predict-miR-69 21 GGATCCAAACGCAACCGAACA 3.86 0.00 3.44 9.49
Predict-miR-70 22 AACATATGATGTTAACTAGGAG 0.00 0.00 0.54 1.81
Predict-miR-71 20 CTGGAATAGCTCAGTTGGTT 46.29 23.53 0.00 9.49
Predict-miR-72 21 GTTTGGGTCTCAATTACATCC 0.00 0.88 0.54 0.00
Predict-miR-73 20 TCGATCAGAACATCTGGCTT 1.54 1.77 0.00 0.00
Predict-miR-74 21 TAGCCTAAAACCGACGGGAAT 0.00 0.00 3.44 2.71
Predict-miR-75 21 TTTAACGGATAGAGAATCTTC 10.42 11.18 17.19 12.65
Predict-miR-76 21 GGGAGATTGGAGGGGCTAAAA 2.31 0.00 4.34 3.16
Predict-miR-77 20 AGCAGGAGGAAGGAGAGGAG 11.57 0.00 1.09 0.00
Predict-miR-78 22 AGAGATTTTTATTTATAGTGTT 0.00 0.00 1.81 1.36
Predict-miR-79 21 TGCATTCAATCAAAATCCAAC 0.00 0.00 5.07 1.81
Predict-miR-80 21 GTTAACGGATAGAGAATGTTC 0.00 0.00 2.53 0.45
Predict-miR-81 22 CTCCTGACCGTTGGATTCCAGT 1.16 3.82 4.52 6.78
Predict-miR-82 21 TTTATGGAACGAAGGAAGTAG 0.00 0.00 0.91 3.16
Predict-miR-83 21 CGATCCAAACGCAACCGAACA 3.86 0.00 3.26 9.49
Predict-miR-84 22 TAGACACAGATGGACCCTACAA 2.31 1.18 0.00 0.00
Predict-miR-85 20 TCATTTCGGCTCAGTCTTTC 16.59 7.65 0.00 9.94
Predict-miR-86 22 AGGTTAAGGACCTAGAAATGTA 0.00 1.18 2.71 2.71
Predict-miR-87 21 GAGGATTGAAGAGGCTAAAAT 0.00 0.00 34.55 29.81
Predict-miR-88 21 TTCTAGGTCTTGAACTTGTTA 2.70 1.77 0.00 0.00
Predict-miR-89 21 GCTTATTTACGTCGGTTTTAG 0.00 0.00 1.45 1.36
Predict-miR-90 21 GAGTTGATCTAGGTAATGAGT 2.31 1.77 0.00 0.00
Predict-miR-91 21 TTTTAGCCCCTCCAATCTAGT 1.93 1.18 3.26 3.16
Predict-miR-92 21 GTGATTATACCATTCTCTCAC 0.00 1.18 0.00 2.26
Predict-miR-93 21 ATGTCAGCAAAAACCAGTTTC 9.64 3.24 4.88 7.23
Predict-miR-94 22 GATTTTGAGCTTTACTGTTGGA 0.00 0.00 1.09 4.97
Predict-miR-95 21 AGGTCTTGTTTGGCTGCACTT 1.16 0.00 0.54 0.00
Predict-miR-96 20 TGTTGGTCAAAGTTTCAAAA 0.00 0.00 1.45 2.71
Predict-miR-97 21 TTTAGCCTCTACAATTCTCTC 0.00 0.00 29.31 25.74
Predict-miR-98 22 GGCTGACATGACCAAGTTCAAC 0.00 0.00 1.27 1.36
Predict-miR-99 20 TTGTGGTGATGAATTATGAA 5.79 15.88 12.84 21.68
Predict-miR-100 21 CGTTAGATTTTGATTGGATGT 1.16 0.00 1.45 0.00
Predict-miR-101 21 GTTGATCTAGATAATTAGTGA 2.31 1.77 0.00 0.00
Predict-miR-102 21 TGTTCGGTTGCGTTTGGATCC 0.00 0.00 3.44 9.49
Predict-miR-103 21 ACTCATTACCTAGATCAACTC 2.31 1.77 0.00 0.00
Predict-miR-104 21 ATCTAGATCTAACGGACTAAA 0.00 2.06 3.26 0.00
Predict-miR-105 23 TGCTCAGCAGTCAGTCAGTCAGT 3.09 0.00 1.81 3.61
Predict-miR-106 21 ATTAAATCTGGACCCTTCATC 5.01 2.35 0.00 2.71
Predict-miR-107 21 CCCGATGAATGTACATGATTT 0.00 8.53 3.98 4.97
Predict-miR-108 21 TGATCCAGACACAACCGAACA 0.00 9.41 0.00 13.55
Predict-miR-109 20 AACCAACTGAGCTATTCCAG 0.00 23.53 0.00 9.49
Predict-miR-110 21 ACTAGTTACCTAGATCAACTC 2.31 1.77 0.00 0.00
Predict-miR-111 21 ATGGATTTTAATTGGATGCAC 2.31 1.77 0.00 0.00
Predict-miR-112 21 TAGATTTTGATTGGATGCATC 0.00 0.00 5.79 2.26
Predict-miR-113 21 TGTTCGGTTGTGTCTGGATCA 7.33 9.41 9.05 13.55
Predict-miR-114 21 TTTTGTTAATGTTTGGAGTAG 11.96 15.00 0.00 6.78
Predict-miR-115 21 TGGATTGTATAATCTAGATAC 4.24 2.06 0.00 0.00
Predict-miR-116 20 GCTCTATCTTTAAGCAACTT 0.00 3.53 0.00 5.42
Predict-miR-117 21 AGGTCTTGTTTGGATGCACTG 1.16 0.00 0.54 0.00
Predict-miR-118 21 TTATGATATGTTACTCTACTA 0.00 0.00 5.25 4.07
Predict-miR-119 22 CGCCGAGTTCTGTAGCTAGAGC 133.46 0.00 86.11 0.00
Predict-miR-120 21 CCGAGGCGGGTTCTTCTCCTA 0.00 0.00 0.72 2.71
Predict-miR-121 21 GAGATTGGAGGGGCTAAAATC 2.70 0.00 4.34 3.61
Predict-miR-122 23 TTCGAATTCCTGTCTATAATGCA 74.45 0.00 1.63 0.00
Predict-miR-123 21 GAGTGGATTGTAGAGGCTAAA 0.00 0.00 30.93 25.29
Predict-miR-124 21 AGAACTACAATTTTCTAAGGG 0.00 0.00 1.27 1.36
Predict-miR-125 22 AAGGCTGACATGACCAAGTTCA 0.00 0.00 1.27 1.36
Predict-miR-126 21 TTTCTAGGTCTTGAACTTGTT 0.00 0.00 1.27 1.36
Predict-miR-127 21 CTCGACGACGGTAGCCAACAG 3.09 2.35 0.00 0.00
Predict-miR-128 23 TCCTTGACCTGATATACTTTAGC 1.93 4.71 3.26 4.07
Predict-miR-129 23 TATCCGGGCTTGTTTCGTAGAAA 1.54 1.77 0.00 0.00
Predict-miR-130 21 TATGCAGAACAATTTACAGAC 27.39 19.12 38.35 31.16
Predict-miR-131 20 GTTTAGGGATTTTTGGAGTT 1.54 0.00 0.00 7.68
Predict-miR-132 20 ATGTGATGATATAGCTTTAA 0.00 2.06 0.00 1.81
Predict-miR-133 23 ACTGACTTACTGACTGCTGAGCA 3.86 3.24 2.17 4.52
Predict-miR-134 21 TTTAGCCTCTACAATCCACTC 0.00 0.00 30.93 25.29
Predict-miR-135 21 CTTGTTCGGTTGCGCCTGGAT 6.17 8.24 6.33 4.97
Predict-miR-136 21 CTACTCCAAACATTAACAAAA 12.34 0.00 0.00 7.68
Predict-miR-137 21 TGTTCGGTTGCGTTTGGATCG 0.00 0.00 3.26 9.49
Predict-miR-138 21 GAGGATTGGAGAGGCTAAAAT 0.00 0.00 29.49 25.74
Predict-miR-139 23 TGGATCCTGGAGATAAGGCTGAA 33.94 28.82 62.59 0.00
Predict-miR-140 21 GAAAAGAACTTTCAAGAGAGA 5.01 55.88 0.00 22.13
Predict-miR-141 23 GGGCCTGATGCCACGTCTCTGTT 1.54 0.00 0.54 3.16
Predict-miR-142 21 TAGTAGAGTAACATATCATAA 0.00 0.00 5.25 4.07
Predict-miR-143 21 GTGGATTGTAGAGGCTAAAAT 0.00 0.00 30.93 25.29
Predict-miR-144 22 TTGGGGCGTAGCGTGAAAGCTG 1.16 0.00 0.00 1.36
Predict-miR-145 21 GAACATTCTCTATCCGTTAAC 0.00 0.00 2.53 0.45
Predict-miR-146 20 TTGAGAAAATTCATGAACGT 1.93 0.00 2.35 0.00
Predict-miR-147 21 GAAGATTCTCTATCCGTTAAA 10.42 11.18 17.19 12.65
Predict-miR-148 21 GAGAAGATTCTCTACCCGTTA 13.89 16.18 0.00 14.00
Predict-miR-149 22 AGGAGGTCCTGGACACATAAGT 0.00 1.18 5.43 4.07
Predict-miR-150 21 GATGAAGGGTCCAGATTTAAT 5.01 0.00 0.00 2.71
Predict-miR-151 21 TATCCCTCAGGATGCCACATC 0.00 0.00 1.27 2.26
Predict-miR-152 22 GATTTGGAGCTTTACTGTTGGA 0.00 0.00 1.45 5.87
Predict-miR-153 20 GGTGTAGTTGCTGATCCATA 0.00 2.94 0.54 0.00
Predict-miR-154 21 CTTGTTTGGGAACAAGGATAG 0.00 0.00 1.63 2.71
Predict-miR-155 21 GATTTTAGCCCCTCCAATCTC 2.70 0.00 4.52 3.61
Predict-miR-156 21 GTATCCTTGTTCCCAAACAAA 3.09 0.88 2.35 0.00
Predict-miR-157 22 TAAGAGATTGTTATTTATAGTG 0.00 0.00 1.81 1.36
Predict-miR-158 21 GTGAGAGAATGGTATAATCAC 0.00 1.18 0.00 2.26
Predict-miR-159 21 GGGATTAGAGGGGCTAAAATT 0.00 0.00 0.72 0.90
Predict-miR-160 21 ACCGTGGCTCCTGCTCCTGAT 0.00 0.00 9.05 2.71
Predict-miR-161 23 ATGCTAACACTGAACATTTTAGG 0.00 2.94 0.00 4.52
Predict-miR-162 20 GAGCCCAGCATTGTTATTTT 0.00 1.47 0.54 0.00
Predict-miR-163 23 GTGCTGTGATGAAGATGCTCAAC 92.57 252.07 98.59 168.01
Predict-miR-164 21 GAGAGAAGGGTATAATCACAT 0.00 0.88 0.00 1.36