Skip to main content

Table 1 List of primers used in this study

From: Comparative characterization of two GDP-mannose dehydrogenase genes from Saccharina japonica (Laminariales, Phaeophyceae)

Primer Sequence (5′ to 3′) Product size (bp) Description
GMD1-3O TGGTCCACAACTACGCCAACGGGCTCAAG 730 3′-RACE for Sjgmd1
GMD1-3I CGACGCTCAGAAGGTGCT
GMD2-3O TTCCACCCGGACGACTGCCCGTCGGAC 491 3′-RACE for Sjgmd2
GMD2-3I CGACACCCGGGAGCGCATGTCCAAC
GMD1-5O GGGACTGCTCAACGAGCTTCAGCACC 352 5′-RACE for Sjgmd1
GMD1-5I GGCACCGAGAGGAGCACAATCTCAGG
GMD1-F CATATGATGGCTGAGGTAATGCCCAAGGAGAGC 963 ORF-PCR for Sjgmd1
GMD1-R GAATTCTTAGGTGGTGAGCGAGTCGGGCGA
GMD2-F CATATGATGGCCGAGCCCGAGGTGAAGAAGT 948 ORF-PCR for Sjgmd2
GMD2-R GAATTCTTAGATGATAAGCTCGCTCGGCGAC
qGMD1-F TCCTCTCACTCTTTCGGCATCC 128 qRT-PCR for Sjgmd1
qGMD1-R CACCCGATCTGGATGATGCTC
qGMD2-F TGCTACCTGAGCCGCAAATACG 126 qRT-PCR for Sjgmd2
qGMD2-R CCGCCAAGAACTCCCTGAAGACC
Actin-F GACGGGTAAGGAAGAACGG 184 qRT-PCR for β-actin
Actin-R GGGACAACCAAAACAAGGGCAGGAT