Skip to main content

Advertisement

Table 1 Primers used in this study

From: Overexpression of Vitreoscilla hemoglobin increases waterlogging tolerance in Arabidopsis and maize

Primers Sequence (5´-3´) Usage
VHb c-forward ATGTTAGACCAGCAAACCATTAA RT-PCR for full-length CDS of VHb
VHb c-reverse TTATTCAACCGCTTGAGCGTACA RT-PCR for full-length CDS of VHb
VHb forward CCAGCAAACCATCAACATCA Amplifying the VHbgene
VHb reverse CGTAAAGGTCAGCCTCAACC Amplifying the VHb gene
VHb q-forward GACTATCAACATCATCAAGGC qRT-PCR for VHb gene
VHb q-reverse GACATCAGCAATAACACCGTA qRT-PCR for VHb gene
ADH1 forward GTGGCTGTTTTCGGTTTAGGA qRT-PCR for maize ADH1 gene
ADH1 reverse ACTGGCTTGTTGTGGTCTTTT qRT-PCR for maize ADH1 gene
Ara-Actin1 forward CCCCTGCTATGTATGTGGCTAT qRT-PCR for ArabidopsisActin1 gene
Ara-Actin1 reverse GACAATTTCACGCTCTGCTGT qRT-PCR for ArabidopsisActin1 gene
Maize-Actin1 forward TGTTGCTATCCAGGCTGTTCT qRT-PCR for maize Actin1 gene
Maize-Actin1 reverse TCATTAGGTGGTCGGTGAGGT qRT-PCR for maize Actin1 gene