Skip to main content

Table 2 Gene specific primers and PCR annealing temperatures to amplify genomic and cDNA sequence from members of the TaHKT2;2 gene family and qRT-PCR for TaHKT2;1 and TaHKT2;2 genes

From: A comparative gene analysis with rice identified orthologous group II HKT genes and their association with Na+ concentration in bread wheat

  Forward primer Reverse Primer
Gene Primer Primer sequence (5’-3’) Primer Primer sequence (5’-3’) Annealing Temperature °C
TaHKT2;2 7AL-1 2;2AF1 CCATCTATCTAACTCCAATGACTG 2;2AR1 CTCTCAGTGCCCATACCAT 54
TaHKT2;2 7AL-1 2;2AF2 TCAATACCATGCTCTTCACG 2;2AR2 AGACGCTCTGCTTCTCTGC 55–50
TaHKT2;2 7AL-1 2;2AF3 GGGGCAAACAAGAGAAGAA 2;2ADR1 CTAGCTCCTCTGCCTGTG 55–50
TaHKT2;2 7BL-1 2;2CF1 CTATCTAACTCCAATGCCTATC 2;2BR1 GCAAGTGGTTGAAACTCACAC 60–50
TaHKT2;2 7BL-1 2;2BF2 CTGTTGGCATACATGGTATC 2;2BR2 ATGGACAGTCCTACGTTCATA 65–55
TaHKT2;2 7BL-1 2;2BF3 CCGTTGCCATCACACTCTTG 2;2ADR1 CTAGCTCCTCTGCCTGTG 60–50
TaHKT2;2 7DL-1 2;2ADCF1 CACACTGCCATCTATCTAACTC 2;2DR1 ACAGTCTTCTCTTGTTCGCT 55–50
TaHKT2;2 7DL-1 2;2DF2 TGCTTTTCTCCATACCCA 2;2ADR1 CTAGCTCCTCTGCCTGTG 55–50
TaHKT2;1 7AL-1 2;1AF1 TCGGCTCTTATCAGAACACA 2;1AR1 CCACACGTTGATAGATAATGTC 55
TaHKT2;1 7AL-1 qPCR2;1AF1 ATGTCCCCTGCCATTGTAGAAT qPCR2;1AR1 CGTGTTCTCATTGGTGGTTTTACTG 60
TaHKT2;1 7AL-1 qPCR2;1BF1 TGCGTTTTGCTAATTTGCCTG qPCR2;1BR1 GATAAGAGCTGAGCCCATCCAAG 60
TaHKT2;1 7DL-1 qPCR2;1DF1 ACTGTTTTTCTCTCCTCAACGCTT qPCR2;1DR1 TGCCTTTTGTGCTCGCTTC 60
TaHKT2;2 7AL-1 qPCR2;2AF1 GATATGGGCACTGAGAGGACTATGA qPCR2;2AR1 AAACAGCATTTTATTCAGCGAGAT 60
TaHKT2;2 7BL-1 qPCR2;2BF1 GCTGCTTGAACTGGAATGCG qPCR2;2BR1 GTGTTCTGTGATGCCCCTCTTGT 60
TaHKT2;2 7DL-1 qPCR2;2DF1 GATTCACTTGTCCTATTTTGTTGTCG qPCR2;2DR1 GCAGGGAAACAAACATCTCTCTG 58
TaActin TaActin_qR TGGCACCCGAGGAGCACCCTG TaActin_qR GCGACGTACATGGCAGGAACA 60
GAPDH GAPDHF CGCCAGGGTTTTCCCAGTCACGAC GAPDHR TCAC ACAGGAAACAGCTATGAC 60
TaEFA TaEFA_qF GATTGGCAACGGCTACG TaEFA_qR CGGACAGCAAAACGACC 60