Skip to main content

Table 1 PCR primers details

From: Novel alleles of the VERNALIZATION1 genes in wheat are associated with modulation of DNA curvature and flexibility in the promoter region

Primers Primer sequence (5'-3') Primer design Annealing temp. °C Amplified region Allelic variant PCR product size (bp)
VRN1AF gaaaggaaaaattctgctcg Yan et al. [19] 60 VRN-A1
promoter
vrn-A1 713
VRN1-INT1R gcaggaaatcgaaatcgaag Vrn-A1a.1 853, 944
      Vrn-A1a.2 853, 924, 944
      Vrn-A1a.3 765,853
      vrn-A m 1 705
      Vrn-A1b 691
      Vrn-A1d 685
      Vrn-A m 1g 681
      Vrn-A m 1a 671
      Vrn-A1e 659
      Vrn-A1f 658
      vrn-A m 1b 656
Vrn-A1-intr_F ccgtcgaaaggatcgctactg This study 60 VRN-A1
intron-1
vrn-A1 541
Vrn-A1-intr_R1 cttgtccccgtgagctacttac 60   
Ex1/C/F gttctccaccgagtcatggt Fu et al. [20] 58 VRN-A1
intron-1
Vrn-A1c (Langdon) 522
Intr1/A/R3 aagtaagacaacacgaatgtgaga 58 Vrn-A1c (IL369) 2188
Pr1 tacccctgctaccagtgcct Shcherban et al. [22] 60 VRN-B1
promoter
VRN-B1.f 968
Pr2 ggccaaccctacaccccaag 60 VRN-B1.s 958
     VRN-B1.m 965
Pr1 tacccctgctaccagtgcct Shcherban et al. [22] 60 VRN-B1
promoter
Vrn-B1(ins) 1256
PrB/Ins/r2 tgcggtacgggttatccag This study 60   
Ex1/C/F gttctccaccgagtcatggt Fu et al. [20] 61 VRN-B1
intron-1
Vrn-B1a 1091
Intr1/B/R3 ctcatgccaaaaattgaagatga 61 Vrn-B1b 1055
     Vrn-B1c 705
Ex1/C/F gttctccaccgagtcatggt Fu et al. [20] 61 VRN-B1
intron-1
vrn-B1 1531
Intr1/B/R4 caaatgaaaaggaatgagagca 61   
FT-B-INS-F cataatgccaagccggtgagtac Yan et al. [3] 63 VRN-B3
promoter
Vrn-B3a 1765
VRN4-B-NOINS-R ctatccctaccggccattag 63   
VRN4-B-NOINS-F2 gctgtgtgatcttgctctcc Yan et al. [3] 63 VRN-B3
promoter
vrn-B3 691
VRN4-B-NOINS-R ctatccctaccggccattag 63 vrn-B3b 1581