Novel and conserved miRNAs in the halophyte Suaeda maritima identified by deep sequencing and computational predictions using the ESTs of two mangrove plants

Table 2 Novel miRNAs predicted through bioinformatics approach

miRNAs	Sequence (5’-3’)	LM (nt)	Precursor accession^b	LP (nt)	MFE (Kcal/mol)
			(R. mangle
			H. littoralis
			S. maritima)
sma-miR1	AAUAGGUACUGUAACUGGUAUU	22	SRX001383.5101	126	−37.8
			NP	--	--
			S.maritima380087	85	−15.60
sma-miR2	AGGGACCAGGAGAUUGGAUC^a	20	SRX001383.146244	75	−19.0
			NP	--	--
			S.maritima40845	73	−15.20
sma-miR3	CGGAAUAUGGUAAAGUAGCUC	21	SRX001383.195972	70	−19.7
			NP	--	--
			S.maritima1868968	70	−20.10
sma-miR4	CGUGGAUGUUCUUAUUUGGAC	21	SRX001383.88652	116	−30.4
			SRX001410.01205	141	−30.53
			S.maritima870097	115	−29.0
sma-miR5	CUUGGUAUGGAAGUUAUGCAUG^a	22	SRX001383.176415	71	−19.7
			NP	--	--
			S.maritima37179	69	−20.10
sma-miR6	GCAUGGCUGUCGUCAGCUCGUG	22	SRX001383.110283	67	−33.5
			NP	--	--
			S.maritima40845	89	−21.60
sma-miR7	UUUUCUUGACCUUGUAAGACC	21	SRX001383.115761	90	−40.8
			NP	--	--
			S.maritima39969	134	−28.73

Prediction was done after alignment of the putative miRNA sequences with the ESTs of the mangrove plants R. mangle and H. littoralis available at NCBI database and then with ESTs of S. maritima at Bionivid, Bangalore, India. SRX001383 and SRX001410 are the accession numbers of R. mangle and H. littolalis, respectivey in NCBI database. LM mature miRNA length, LP precursor length, MFE minimum free energy, NP precursor not present
^amark against a sequence indicates the presence of miRNA*
^bsee Additional file 4 for sequences and other details

ISSN: 1471-2229