Skip to main content

Table 3 Primers used for gene validation and expression analyses

From: Transcriptomic comparison of the self-pollinated and cross-pollinated flowers of Erigeron breviscapus to analyze candidate self-incompatibility-associated genes

Primers Sequences Size (bp)
EbSRLK1F GGGCAGAATCGGACCCTTAC 95
EbSRLK1R TGAGACCCTTCTTCGTTGG 95
EbSRLK3F CTAGGCTGTTGCATTCGTGG 293
EbSRLK3R GGTGATTGCTTCAGTCTCATTTGG 293
EbCaM-F AGGCTGAACTCCAAGACAT 118
EbCaM-R TCCTCCTCAGAGTCCGTAT 118