Skip to main content

Table 4 Species-specific Primers Designed for Hakonechloa macra

From: Resolving deep relationships of PACMAD grasses: a phylogenomic approach

Primer Name Sequence
1FHma CATTACCCACTTGTCCGACTGTTGC
2RHma CGATACTGGAACTCAGAGCATAGGAGG
12RHma GCATGATATTGGGGAATCTCCTTGC
31FHma GCTGCGTGTATAAGAGCCGAAATGGG
31RHma GGCAACGAGCATCCAAAACCAAAAG
31FHma2 GCCCGAAATGGAGTGGGTCCTTCC
31RHma2 GGTTTTGGATGCTCGTTGCCGCTAG
39FHma CCTTGGGGTAAAGAGTTTACACTGC
99RHma CCTGTAGTAGGGATCTGGTTCACTGC
101FHma GCGACCCCACAGGCTTGTACTTTCG
101RHma CTTCGTCTACCCACTTCTCTTTCAGG
116FHma GAACCTGGAGGAGTTAGGTATGTAGG
116RHma GGAGTCGGCAAATGGACTGAGAATG
148FHma GGCGTTTTTTTAGTGAGTCCTGG
148RHma CTCTTTGAGAGACCCCGCTTATTGC
148FHma2 GAGACCGACCCACTTCCTATCTAG
169FHma GCCGTTATTGTCGCAAGCATACGAC
169RHma GCAGAATTTCTCTAGTAGGAGCGTC
169FHma2 CTCTATGGTTTGGGGCTTTAGCAGG
169RHma2 CACTCGGATAAACGCAGCAACACGG
184FHma GCAACAGTCGGACAAGTGGGTAATG