Skip to main content

Table 1 Predicted candidate litchi-specific miRNAs

From: MicroRNAs and targets in senescent litchi fruit during ambient storage and post-cold storage shelf life

Name

Sequence

Len

Unigene

Match site

Str

Normalized abundance

0d

4d

14d0h

14d24h

14d48h

Total

lch-miRC1

TGGGTGAAAGATGCAGCAAAATCT

24

lychee_29764

294

+

72.4

53.5

53.6

103.8

130.9

414.2

lch-miRC2

TTCGATTCGAACCCAGAGATGTCT

24

lychee_3356

8439

+

28.8

29.4

63.8

53.1

41.6

216.7

lch-miRC3

TTGTGGTGCTATTGTTTCTCCTCT

24

lychee_28612

3025

+

14.9

21.7

23.5

29.3

25.7

115.1

lch-miRC4

TTCAAGACAACAACTATTGGCTCT

24

lychee_43109

2259

+

47.1

26.4

79.6

82.7

34.8

270.7

lch-miRC5

CCTGTTGAGCTTGACTCTAGTCT

23

lychee_41226

539

21.5

6.5

12.9

20.4

5.3

66.6

lch-miRC6

CGAAAAGAACTCTGACTGGTCT

22

lychee_57528

1330

18.1

5.7

35.5

40.8

7.5

107.6

lch-miRC7

ATTTGGTAGTAGCTGAGATTCTCT

24

lychee_25799

986

+

13.1

3.4

6.8

19.9

3.3

46.6

lch-miRC8

CTATCAAACGATGATTGTTGGTCT

24

lychee_32974

83

2.0

3.1

9.1

8.1

1.3

23.6

lch-miRC9

ATTAAAGGAAGAAAAAGGACCTCT

24

lychee_2125

101

7.4

0.5

0.0

10.3

1.0

19.2

lch-miRC10

TGTTGAGCTTGACTCTAGTCT

21

lychee_41226

539

12.5

4.7

7.7

10.3

3.3

38.6

lch-miRC11

CGGAGAAGGGCAATTACTCATTCT

24

lychee_25026

5635

+

1.4

0.3

2.0

3.0

1.2

7.9