Skip to main content

Table 1 Predicted candidate litchi-specific miRNAs

From: MicroRNAs and targets in senescent litchi fruit during ambient storage and post-cold storage shelf life

Name Sequence Len Unigene Match site Str Normalized abundance
0d 4d 14d0h 14d24h 14d48h Total
lch-miRC1 TGGGTGAAAGATGCAGCAAAATCT 24 lychee_29764 294 + 72.4 53.5 53.6 103.8 130.9 414.2
lch-miRC2 TTCGATTCGAACCCAGAGATGTCT 24 lychee_3356 8439 + 28.8 29.4 63.8 53.1 41.6 216.7
lch-miRC3 TTGTGGTGCTATTGTTTCTCCTCT 24 lychee_28612 3025 + 14.9 21.7 23.5 29.3 25.7 115.1
lch-miRC4 TTCAAGACAACAACTATTGGCTCT 24 lychee_43109 2259 + 47.1 26.4 79.6 82.7 34.8 270.7
lch-miRC5 CCTGTTGAGCTTGACTCTAGTCT 23 lychee_41226 539 21.5 6.5 12.9 20.4 5.3 66.6
lch-miRC6 CGAAAAGAACTCTGACTGGTCT 22 lychee_57528 1330 18.1 5.7 35.5 40.8 7.5 107.6
lch-miRC7 ATTTGGTAGTAGCTGAGATTCTCT 24 lychee_25799 986 + 13.1 3.4 6.8 19.9 3.3 46.6
lch-miRC8 CTATCAAACGATGATTGTTGGTCT 24 lychee_32974 83 2.0 3.1 9.1 8.1 1.3 23.6
lch-miRC9 ATTAAAGGAAGAAAAAGGACCTCT 24 lychee_2125 101 7.4 0.5 0.0 10.3 1.0 19.2
lch-miRC10 TGTTGAGCTTGACTCTAGTCT 21 lychee_41226 539 12.5 4.7 7.7 10.3 3.3 38.6
lch-miRC11 CGGAGAAGGGCAATTACTCATTCT 24 lychee_25026 5635 + 1.4 0.3 2.0 3.0 1.2 7.9