Skip to main content

Table 1 PCR primers used in this study

From: Linkage mapping, molecular cloning and functional analysis of soybean gene Fg3 encoding flavonol 3-O-glucoside/galactoside (1 → 2) glucosyltransferase

Purpose Target gene Forward primer (5′-3′) Reverse primer (5′-3′)
Cloning of cDNA for sequencing GmF3G2″Gt AATCACGTCCTTTGCACATA CAAAACCATTGCCATTCATG
Sequencing of cDNA GmF3G2″Gt AGGCTGTGCACTATTGTACT TCACAATGCTCACAGCTTTA
CCATATATGGATTACATTGG CACTTCCAAAGCAACAATAA
TTCTTGCACACCCTTCTGTA GACAGAGCTAGCAGTACAAT
Cloning of 5′ upstream regiona GmF3G2″Gt   GTGTGTGTCTCTGGTGTAGTAATCATG
  CTCACACAAAACAGAGGTTCAATACGAGG
Sequencing of 5′ upstream region GmF3G2″Gt ACAACGGTCATATATGCATG TGGCGGAGAGGAAGAAGATA
ACAACGGTCATTTCTGCATG CTCTCTGAAATGGATCCCAA
GTCAACAATGAAGGACATGG TAGAAATGCACGTAGTAGGT
  TCCACCACAATATGCTATGT
dCAPS analysis GmF3G2″Gt CCAAACTCACGAGGCTGGT TCCTCCAAATCTAAAGTTGG
Cloning for functional analysisb GmF3G2″Gt GCCGGAGCTCATGAAATCACGTCCTTTGC GCCGCTCGAGTCAAATTCCCTCTACAATCTC
Real-time PCR GmF3G2″Gt AGAACCAAAGGATCTCCGTT GTTTTTGCCAAGGAGATAAGT
actin GTCCTTTCAGGAGGTACAACC CCACATCTGCTGGAAGGTGC
  1. aGene-specific primers for genome walking.
  2. bRestriction sites incorporated in primers, SacI site in forward primer and XhoI site in reverse primer are italicized.