Skip to main content

Table 1 Details of salt tolerance gene, respective genbank LOC number, motifs with repeat number and location in sequence, primers with Tm and molecular weight of expected band

From: Identification and analysis of novel salt responsive candidate gene based SSRs (cgSSRs) from rice (Oryza sativa L.)

Gene bank LOC No. Gene Forward (Tm) Reverse (Tm) Expected amplicon size Number of alleles PIC value Function (Motif) repeat* Location of motif
LOC_Os11g08210 OsNac5 ATGTGATTAGAGTCGCTTTCAGTTGG (56.9C) CCAGCTTGTACTTGTGCCAGCC (58.4C) 238 bp 10 0.110 TF (TAA)18 3′UTR
LOC_Os10g25010 OsCML8 GAGAATCAGAGCAAGAGTCTGAACCAGC (61C) GTCAGCCGCTTCTTCCTCACCTG (61C) 209 bp 21 0.275 Signaling (CGG)9 CDS
LOC_Os01g32120 OsCML11 CATGCAAGCCTGCGGAGACG (61.2C) CGGTCGAAGGAGCGGAAGATCT (60.5C) 154 bp 42 0.221 Signaling (CAG)10 CDS
LOC_Os02g17500 OsGMST1 AGGAACCAACAGAAGCAAAGGTG (56.3C) GAGGTGATTTGATGCTGTGAGGC (57.4C) 194 bp 25 0.289 Sugar Transporter (AG)10 5′UTR
LOC_Os07g06740.2 OsCPK17 TTGCCTTTTGATCTAGTGCATTGG (57.2C) GTCTTCGTCCTTTACTAAATAGCACTCC (55.8C) 267 bp 21 0.353 Kinase (CT)9/(CT)11 3′UTR
LOC_Os02g04630 OsCAX (D) CTGTTTGGCAATCTGCCAGC (55.6C) CGTCTCGGCAAAATGTTCCTC (56.1C) 139 bp 20 0.326 Ion transporter (CT)18 Intronic
LOC_Os02g04630 OsCAX (T) CTTTGGTTGGTTCAGGACGATG (55.9) GAATTGGAAGCTGTTGGCTCATTC (57.9) 163 bp 18 0.169 (TTA)26 Intronic
LOC_Os07g38090 OsC3H50 GAGGAATTAGACCATTTAACTCGTCGC (58.7) GAATCCGACCCAATCCAATCAAG (58.3) 214 bp 24 0.199 RNA processing (TC)9 5′UTR
LOC_Os06g48590.1 OsMAPK4 GACATCTAAGTGCCGCGTGTTC (56.2) TACATGCAGCGTCGAATCGAAG (57.6) 254 bp 17 0.358 Kinase (CT)12 5′UTR
LOC_Os01g54600 OsWRKY13 CCATGCGTACATACACGTTCATGTG (57C) GATGGGTGCAGCTTTCAATGATC (57.3C) 246 bp 20 0.370 TF (AG)16/(GA)9 5′UTR
LOC_Os01g72530.1 OsCML31 GTTGATGGATCTGTAAATGCTTCATGG (58.8) GGCACCATGGAGCACCAAAC (57.4) 167 bp Not amplified Not amplified Signaling (AT)40 3′UTR
LOC_Os01g45274.1 OsCA1 CCATCGAGTACGCCGTCTGC (57.9) CTTCACCATGAATGTTACACACCCTAC (56.8) 281 bp 35 0.296 Chloroplast photosynthesis (CT)9 Intronic
LOC_Os02g02840.1 OsRacB (D) GCTCCTCCTTCAACCTTCTTCTTTC (57.1C) GTGACGCACTTTATGAACCTGGAC (56.5C) 176 bp 30 0.318 Signaling, GTPase (GA)21 5′UTR
LOC_Os02g02840.1 OsRacB (T) CAAGACCTGCATGCTCATCTCC (56.1C) CCAGATCAAGAACCATAATCCTAGCTC (56.9C) 202 bp 14 0.386 (TTC)9 Intronic
LOC_Os05g51670.1 OsUGE1 CACAACGCCAACAACCTCGAC (57.7C) GCTTATCGAGATGGGAATGGTTG (56.5) 154 bp 11 0.087 Nucleotide sugar metabolism (TC)9 Intronic
LOC_Os06g48590.1 OsMSRMK3 CACCTCCATTTCCCATTCCACC (58.9C) CGAATCGAAGGCGGCAGCTATAG (60.9) 201 bp 27 0.340 Signaling, Kinase (CT)12 5′UTR
LOC_Os02g35190.2 OsCLC-1 CAGAGAAGCCAAGCAAAGAAAGTCTC (58.1C) CCGTGCTCTCGATGTCGTAGTTG (59.2) 179 bp 24 0.322 Ion trasport (AGA)11 5′UTR
LOC_Os09g13570 OsbZIP71 CTCAGTAAGCTCCCTGTAGTTGTAGCC (57.3) GTTCAGGTCATCTTCCGACCTGG (58.5) 259 bp 13 0.323 TF (TA)12 5′UTR
LOC_Os03g02590 OsPEX11-1 GCTGCTCTCGACTTTCTTGTTCC (56.2) ACTAGCCCTGCACAGACTGAAGAG (55.8) 276 bp 21 0.261 Peroxisomal biogenesis (TG)19 Intronic
  1. D- di-nucleotide and T- tri-nucleotide. *subscript denotes the number of repeats.