Skip to main content

Table 1 PCR markers for determining the presence of different alleles of VRN-A1 , VRN-B1 in diploid and polyploid wheats

From: VRN-1 gene- associated prerequisites of spring growth habit in wild tetraploid wheat T. dicoccoides and the diploid A genome species

PCR marker Name Primer (5′→3′) Target allele(s) Expected product size (bp) Annealing temp. (ºC) Reference.
VRN-A1 marker* Vrn1AF GAAAGGAAAAATTCTGCTCG VRN-A1a 876 and 965 55.0 [16,23,31]
  Int1R GCAGGAAATCGAAATCGAAG VRN-A1b 694   
    VRN-A1d 662   
    VRN-A1h 684   
    VRN-A1f 703   
    VRN-A1 704   
    VRN-A1u 705   
    VRN-A1u 713   
T. monococcum VRN-A1 Indel(-)F CGCTCTTATATTTGTTTACCAGGG VRN-A1 1025 50.0 _
Indel(-)R GGGTCAACTATTCTGTGGAG VRN-A1u, VRN-A1u’ no product   
VRN-A1 deletion of 1.4 kb Intr1/C/F GCACTCCTAACCCACTAACC VRN-A1u, VRN-A1u’ 1068 56.0 [24]
Intr1/AB/R TCATCCATCATCAAGGCAAA     
VRN-A1 insertion of 0.5 kb Intr 1 ATCATCTTCTCCACCAAGGG VRN-A1ins 1980 50.0 _
Intr1insR AATGAACAGCACGGAAACAG VRN-A1 1476   
VRN-A1 deletion of 7,2 kb Ex1/C/F GTTCTCCACCGAGTCATGGT VRN-A1L 522 55.6 [24]
Intr1/A/R3 AAGTAAGACAACACGAATGTGAGA     
VRN-B1 marker* P2 TCATGCACGCACACACGGTA VRN-B1 814 55.0 [25]
P5 GGCCAACCCTACACCCCAAG     
VRN-B1 Non-deletion Intr1/B/F CAAGTGGAACGGTTAGGACA VRN-B1 1149 56.4 [24]
Intr1/B/R4 CAAATGAAAAGGAATGAGAGCA     
  1. *These diagnostic markers detect allelic variation at the promoter regions. In other cases variation within intron 1 of corresponding genes is detected.