Skip to main content

Table 2 Details of the PCR primers used in this study

From: An efficient method for zoospore production, infection and real-time quantification of Phytophthora cajani causing Phytophthora blight disease in pigeonpea under elevated atmospheric CO2

S. No. Primers name Primer sequence (5' → 3') PCR T m (°C) Product size (bp) Used for Respond/Remarks
Primers pair 1 ITS 1 TCCGTAGGTGAACCTGCGG 55 ~800 Identification of P. cajani by amplification of ITS sequence Amplified and PCR products sequenced
ITS 4 TCCTCCGCTTATTGATATGC
Primers pair 2 qPCR_F1 CTTTCAGCAGTGGATGTCTAGG 62 127 qPCR quantification of P. cajani Low reproducible results in qPCR
qPCR_R1 GACTAACCCGGAAGTGCAATA
Primer pair 3 qPCR_F2 CTGCGAGTCCCTTGAAATGTA 62 146 qPCR quantification of P. cajani Consistence results in qPCR
qPCR_R2 ATACCGCGAATCGAACACTC
Primer pair 4 qPCR_F3 GGGACGAAAGTCTCTGCTTT 62 110 qPCR quantification of P. cajani Low reproducible results in qPCR
qPCR_R3 CCTGCAATTCGCATTACGTATC