An efficient method for zoospore production, infection and real-time quantification of Phytophthora cajani causing Phytophthora blight disease in pigeonpea under elevated atmospheric CO2

Table 2 Details of the PCR primers used in this study

S. No.	Primers name	Primer sequence (5' → 3')	PCR T _m (°C)	Product size (bp)	Used for	Respond/Remarks
Primers pair 1	ITS 1	TCCGTAGGTGAACCTGCGG	55	~800	Identification of P. cajani by amplification of ITS sequence	Amplified and PCR products sequenced
Primers pair 1	ITS 4	TCCTCCGCTTATTGATATGC	55	~800		Amplified and PCR products sequenced
Primers pair 2	qPCR_F1	CTTTCAGCAGTGGATGTCTAGG	62	127	qPCR quantification of P. cajani	Low reproducible results in qPCR
Primers pair 2	qPCR_R1	GACTAACCCGGAAGTGCAATA	62	127	qPCR quantification of P. cajani	Low reproducible results in qPCR
Primer pair 3	qPCR_F2	CTGCGAGTCCCTTGAAATGTA	62	146	qPCR quantification of P. cajani	Consistence results in qPCR
Primer pair 3	qPCR_R2	ATACCGCGAATCGAACACTC	62	146	qPCR quantification of P. cajani	Consistence results in qPCR
Primer pair 4	qPCR_F3	GGGACGAAAGTCTCTGCTTT	62	110	qPCR quantification of P. cajani	Low reproducible results in qPCR
Primer pair 4	qPCR_R3	CCTGCAATTCGCATTACGTATC	62	110	qPCR quantification of P. cajani	Low reproducible results in qPCR

ISSN: 1471-2229