Skip to main content

Table 1 Primer lists

From: The F-box protein MAX2 contributes to resistance to bacterial phytopathogens in Arabidopsis thaliana

Gene name AGI code Primer sequence
At1g13320 PP2AA3 GCGGTTGTGGAGAACATGATACG
At1g13320 PP2AA3 GAACCAAACACAATTCGTTGCTG
At4g34270 TIP41 GTGAAAACTGTTGGAGAGAAGCAA
At4g34270 TIP41 TCAACTGGATACCCTTTCGCA
At5g15710 F-box GGCTGAGAGGTTCGAGTGTT
At5g15710 F-box GGCTGTTGCATGACTGAAGA
At3g62980 TIR1 GCATTTGCAGGAGACAGTGA
At3g62980 TIR1 AAACGGGCAGTCCCTTATCT
At4g03190 AFB1 GGGGACAGTGATTTGATGCT
At4g03190 AFB1 TGTCTCCAAAAGGGCAGTCT
At5g47370 HAT2 CGAACCATCACCACAATCAC
At5g47370 HAT2 GCAAGGCTTCAAAATTCAGC
At1G28480 GRX480 ACGGAGAGGATGTTGCATGTGTC
At1G28480 GRX480 AATCTCAAGGACCGCCGGATTC
At1G02930 GST1 CAAGGACATGGCGATCATAGC
At1G02930 GST1 TCCCAAACAAGCTTTGAACCA
At2g14610 PR1 CGGAGCTACGCAGAACAACT
At2g14610 PR1 CTCGCTAACCCACATGTTCA