Skip to main content

Table 2 Primers used for modified 5′ RLM-RACE mapping of the miRNA cleavage sites and putative target protein

From: Identification and characterization of cold-responsive microRNAs in tea plant (Camellia sinensis) and their targets using high-throughput sequencing and degradome analysis

miRNAs Targets gene Putative target protein Conserved gene inA. thaliana(E-scroe) Gene-specific primer Nested gene-specific primer
csn-miR319b-1 CV014890.1 Unknown protein   CCACGCTGGGCACTGTATGATGAT  
csn-miR396b-2 JK476458.1 Unknown protein   ATTCCCGCCAACAGCATCAATGTC CACGCATCACCAAACACAGCGATAAG
csn-miR396c FS943373.1 Plant calmodulin-binding protein-related AT5G07820.1(5E-06) AACGCTTTCCACCACCACCTCCAAG CGCAGTCACCTCGGCTTTCTTAGC
csn-miR398 FS954022.1 Rubredoxin-like superfamily protein AT1G80230.1(5E-34) CTTCACCTCCAGGGCATCCAACAAT GTCCCGTGGCAATAGGCATCACATCT
csn-miR408 GD254786.1 Transposable element gene AT5G29056.1(4E-07) GCCAGGGAGAGAGCAAATGAAGAAGTTC CCAGCCTTGTTCACACTGACCACATTGT
csn-miR408 FS955921.1 VQ motif-containing protein AT1G28280.1(1E-12) GCCAGGGAGAGAGCAAATGAAGAAGTTC CCAGCCTTGTTCACACTGACCACATTGT