Skip to main content

Table 2 Sequences of gene specific primers used for quantitative RT-PCR analyses

From: Constitutive overexpression of the pollen specific gene SKS13 in leaves reduces aphid performance on Arabidopsis thaliana

Gene name Forward primer (5' → 3') Reverse primer (5' → 3')
BRL3 GGACATACCCGGGAGTACCT CCCGTGTCTCAGATTTTGGT
SKS11 CAACTGTGGAATGTGGAACG GGTGACAAGACACTCGCGTA
SKS13 GAGCTACGAAGGAAGCAACG CACTGGCGGTTAAGTTCCAT
LOX2 AGATTCAAAGGCAAGCTCCA ACAACACCAGCTCCAGCTCT
VSP2 TACGAACGAAGCCGAACTCT GGCACCGTGTCGAAGTCTAT
PDF1.2 CACCCTTATCTTCGCTGCTC GCACAACTTCTGTGCTTCCA
PAD4 GTTCTTTTCCCCGGCTTATC CGGTTATCACCACCAGCTTT
PR1 GGCCTTACGGGGAAAACTTA CTCGCTAACCCACATGTTCA
ERF1 CTTCCGACGAAGATCGTAGC TCTTGACCGGAACAGAATCC
ACTIN8 GATGGAGACCTCGAAAACCA AAAAGGACTTCTGGGCACCT