Skip to main content

Advertisement

Table 1 Newly identified miRNAs in superior and inferior spikelets during rice grain filling

From: Differentially expressed microRNA cohorts in seed development may contribute to poor grain filling of inferior spikelets in rice

miRNA ID Sequence Length 10DAFS 15DAFS 21DAFS 27DAFS 35DAFS 10DAFI 15DAFI 21DAFI 27DAFI 35DAFI Evidence#
miRn1 TCTTCGATAAGAATGCTGGCA 21 0 0 0 0 0 1.03 0 181.5 0 0 H
miRn2 TGATGTGTAGCACAATGCGGCTT 23 0 0 0 0 0 254.34 176.41 93.89 0 0 H
miRn3 TTGAGACGTAGAGGATAAGGT 21 0 0 0 1.29 1.31 0 1.79 1.58 0 2.31 F
miRn4 TTGGCAACGGACGCGATGGT 20 1.97 0.9 0 0 0 3.27 2.47 2.16 2.2 0.58 F
miRn5 TTTTGCTCAAGACCGCGCAAC 21 0.91 0.45 0 0 0 2.84 1.45 1.78 0.34 0 F
miRn6 TAAAGGAAGAAGAGAGAGAGT 21 0.7 0.6 0 0 0 3.27 0.6 1.14 0.56 0.72 F
miRn7 TGGATACTGGTAGAGGCGCCGCT 23 0 0 0 0 0 0 0 0 0 1.3 *
miRn8 TCCGACGCGAACTGGATGAGGCC 23 0 0 0 0 0 0.6 0 0 0 0 *
miRn9 TTCTGCTTGTGTATCGTCGCC 21 0 0 0 0 0 1.55 0 0.63 0 0 *
miRn10 AAGTGTGTAATGTTGAACGGA 21 0 0 0 0 0 1.03 0 0 0 0 *
miRn11 TGGTGAGCCACTGGGATGAGGATG 24 0 0 0 0 0 0 0 1.01 0 0 *
miRn12 TTTGAGATCTGGTGAGAATGTA 22 0 0 0 0 0 0 0 0.89 0 0 *
miRn13 AAGGGGCGCTTACTGAGAGTTCT 23 0 0.38 0 0 0 0.43 0 0 0.28 0.36 *
  1. #Evidence of identified miRNA, ‘*’ indicates the detection of the corresponding miRNA. ‘F’ indicates that the miRNA were founded at least in five of the ten libraries. ‘H’ represents the abundance of the miRNA higher than 50 TPM in one of the ten databases.