Skip to main content

Table 1 Gene description, primer sequences and efficiency of the selected ESTs.

From: Selection of reference genes for quantitative real-time PCR expression studies in the apomictic and sexual grass Brachiaria brizantha

Gene identification/Gene description E value/ID (%) Primer sequence/Amplicon size Amplification efficiency ± SD* GeneBank Accession Number
Bbriz EF1
Elongation factor-1 alpha
4e-89/
166/179 (92%)
5'ACCCTCCTCTTGGTCGTTTT3'
5'AGCCCCTCATTTCTTCTTGG 3'
105 bp
0.87 ± 0.012 EZ000623
Bbriz EIF4A
Eukaryotic initiation factor 4A
4e-41/
88/100 (88%)
5'TAAGGTGGGGCTTGTTTTTG3'
5'ACAGCAGCACATACCACAGG3'
164 bp
0.94 ± 0.011 EZ000622
Bbriz GAPDH
glucose-6-phosphate dehydrogenase
2e-39/
86/121 (71%)
5'TGAATCTAGTCCATCCGCTTG3'
5'TCATCAGGCAGGGAAGCTA3'
124 bp
0.97 ± 0.009 GE617483
Bbriz GDP
glyceroldehyde-3-phosphate dehydrogenase
6e-22/
48/55(87%)
5'GGGCATTTTGGGTTATGTTG3'
5'TCCCCACTCGTTGTCATACC3'
146 bp
1.01 ± 0.009 EZ000624
Bbriz SUCOA
succinyl-CoA ligase (GDP-forming) beta-chain
e-107/
203/236 (86%)
5'CAGCAAGGGAGGAACCAGTA3'
5'TAGCGCAAGACCATCAACAA3'
130 bp
1.00 ± 0.008 GE617476
Bbriz TUB
putative tubulin alpha-5 chain
4e-51/
96/98 (97%)
5'ATGAAGGCGATGAAGGAGAA3'
5'GTACGCAATGGAATGGAACC3'
112 bp
1.01 ± 0.019 GE617477
Bbriz UBCE1
Ubiquitin-conjugating enzyme
Bbriz UBCE2
4e-31/
64/74 (86%)
5'GGTCTTGCTCTCCATCTGCT3'
5'CGGGCTGTCGTCTCATACTT3'
114 bp
5'ACCAGCACAAATCAAAGGA3'
5'GCCAAAGTATGAGACGACAGC3'
149 bp
0.92 ± 0.013
0.95 ± 0.015
GE617481
Bbriz UBI
ubiquitin/ribosomal protein
4e-06/
28/49 (57%)
5'GTCACTAAGCCATCGGTCGT3'
5'ACACGGACACAACCAGTTCA3'
112 bp
0.94 ± 0.020 GE617482
  1. *Amplification efficiency was calculated using the miner algorithm [21] and range from 0.5 (50%) to 1.5 (150%).