Skip to main content

Table 1 PCR primer sequences, 5'....3'1

From: Fragments of the key flowering gene GIGANTEA are associated with helitron-type sequences in the Pooideae grass Lolium perenne

GIG49660.6F GTCCCGTCTATGATGCGTGA GIG49660.7R CCAGTTCTCATCACTGTTCTGG
GIGgt.1F ATTCCTGCATCTGAAACCAC GIGgt.1R CAGCCAGCACATACGAGTC
GIGgt.2F GCATCAAATGGGAAGTGGAT GIGgt.2R TGCAACTTTGAAGATTGGCC
  1. 1Thermal cycling profile for all primer pairs was as follows: 1 minute at 94°C, followed by 10 cycles of 1 min at 94°C, 1 min at 60°C (with the temperature reduced by 1°C per cycle), 1 min at 72°C, followed by 30 cycles of 1 min at 94°C, 1 min at 50°C, 1 min at 72°C