Skip to main content

Table 2 Test primer pairs used for semi quantitative RT-PCR amplification: names, TAIR database numbers, and predicted product sizes in bp are listed.

From: A compatible interaction of Alternaria brassicicola with Arabidopsis thalianaecotype DiG: evidence for a specific transcriptional signature

name function TAIR ID sense primer antisense primer bp
PATP proteasome subunit AT5G19990 GGCGTCCTGAGACAGCGATGGAG CAGGCCTGAGAAGAGCTTGATCCAG 938
GS cytosolic glutamine synthetase AT1G66200 GAAGGATGTGAACTGGCCTCTTG GTAAGGGTCCATGTTTGAAGCTG 615
PDIOX pathogen inducible dioxygenase AT3G01420 GTATGCGACGCCCTCAAGGATG CCTTGAGACTCTCTGTAGTATTCACC 936
MTH homocysteine methyltransferase AT5G17920 GCTGATCTCAGGTCATCCATCTG GATTGAGCTTCTTCTGCTGAGCATC 1170
MDH malate dehydrogenase AT5G09660 GGAAAACTGCAGAGCTAAAGGTGG CCAAGCTGATACACTTCCTCTGC 878
PRX42 peroxidase 42 AT4G21960 GACCACAACGAGAGTATCTCCGTC CAAGCAGAGAACTCAACACACCAGAG 544
RD21A cysteine proteinase (RD21A) AT1G47128 GTGAGAGAAGGACTAGCCTACGGTAC CACAAACCGGGTACTCGTGAG 914
3OA 3-oxoacyl-(acyl-carrier protein) AT1G24360 GATGAAAACCGCTCTTGACAAATG CATCAATGGTGAATGCCTGTCC 511
MO1 aromatic-ring hydroxylase AT4G15760 GTTTGCTTGTCGTGCGGTGAGAG CTGCACCGAAAGCCCGAGTAATC 555
PR1 PR1 pathogen related AT2G14610 TCGTCTTTGTAGCTCTTGTAGGTG TAGATTCTCGTAATCTCAGCTCT 590
GLIP1 lipase, defense response AT5G40990 CGATTGTGCACCAGCCTCATTGGTT CAGCGCTTTGAGATTATAGGGTCC 429
PR2 PR2 pathogen-related, cellulase AT3G57260 CGTTGTGGCTCTTTACAAACAACAAAAC GAAATTAACTTCATACTTAGACTGTCGAT 870
PR3 PR3 defense response chitinase AT3G12500 CGGTGGTACTCCTCCTGGACCCACCGGC CGGCGGCACGGTCGGCGTCTGAAGGCTG 583
PR4 PR4 hevein-like defense protein AT3G04720 GACAACAATGCGGTCGTCAAGG AGCATGTTTCTGGAATCAGGCTGCC 552
PR5 PR5 thaumatin-like AT1G75040 ATGGCAAATATCTCCAGTATTCACA ATGTCGGGGCAAGCCGCGTTGAGG 484
PDF1.2 defensin AT5G44420 GCTAAGTTTGCTTCCATCATCACCCTT AACATGGGACGTAACAGATACACTTGT 237
EIN2 ethylene signal transduction AT5G03280 TGCAGCTCGCATAAGCGTTGTGACTGGTA CGCTCTCTCCATTTAACCGAGTTAACAC 379
EIN3 ethylene signal transduction AT3G20770 GATGTTGATGAATTGGAGAGGAGGATG ACGTCTCTGAGGAGGATCACAGTGT 470
ERF1 ethylene response factor AT3G23240 CGGCTTCTCACCGGAATATTCTATCG TCTCCGAAAGCGACTCTTGAACTCTCT 415
ACT2 actin 2 AT3G18780 TCACCACAACAGCAGAGCGGG GGACCTGCCTCATCATACTCGG 257
UBC ubiquitin conjugating AT5G25760 GGCATCAAGAGCGCGACTGTT CTTTCTTAGGCATAGCGGCGAG 217
CBP20 Cap-binding protein 20 AT5G44200 TTGTGGCTTTTGTTTCGTCCTG CGTGGGTTCTTCTCCGGTCTC 409