Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 4 Real-time-PCR primers used in this study.

From: Gibberellin mediates daylength-controlled differentiation of vegetative meristems in strawberry (Fragaria × ananassaDuch)

Gene Forward primer 5' = > 3' Reverse primer 5' = > 3'
Rubisco small subunit 1a tggcctccagttggtttgaa ccatttgttgcggagaagga
Ubiquitin 11 cagaccagcagaggcttatctt ttctggatattgtagtctgctaggg
GA3ox cctcacaatcatccaccaatcc cgccgatgttgatcaccaa
GA2ox caccatgcccagagcttca aggccagaggtgttgttggat
GID1b gtcccagttgacggtgtctt attcacaaagccccattgag
GID1c ttccatggtggaagctttgc accgagacgacaacagcattg
RGA tcagctggcttcggatactgtt ttaccggctcgaaattcgg
GAI cgattctcgacttcgctgac atctgctggtggttctgcat
SLY tggccgaggaggacgatta ccctggtccttcaacgatcac
SPY tgcggtgtcaaattgcatca ggcaacactcaagatggattgc
GAST1 accctgttgaggctgatgga ccgagacgataaacgacacctt
XERICO ccacttgacttgtggccatgt ctcctccacaggcattaaagga
  1. Tm value of the primers is 60 ± 1°C.