Skip to main content

Table 3 Oligonucleotides used to generate GFP fusions.

From: Cytosolic N-terminal arginine-based signals together with a luminal signal target a type II membrane protein to the plant ER

Primer 5'-3' sequence
  At glucosidase I as template
RGCS150 GACTAGTACACAAATGCCGCATAAC
RGCS90 GACTAGTAAAAGGAGTGATAACCCT
FΔ13GCS90/150 CGGGGTACCCCATGAAATCATCATCATTATCTCCC
FR/L4 CGGGGTACCCCATGACCGGAGCTAGCCTTCTGAGCGCGCTTGGTCTAATCAAATCATCA
FR/A4 CGGGGTACCCCATGACCGGAGCTAGCGCTGCGAGCGCGGCTGGTGCAATCAAATCATCA
FR/L6-7 CGGGGTACCCCATGACCGGAGCTAGCCTTCTGAGCGCGCGT
FR/L10L12 CGGGGTACCCCATGACCGGAGCTAGCCGTCGGAGCGCGCTTGGTCTAATCAAATCATCA
FR/L6L10 CGGGGTACCCCATGACCGGAGCTAGCCTTCGGAGCGCGCTTGGTCGAATCAAATCATCA
FR/L6L12 CGGGGTACCCCATGACCGGAGCTAGCCTTCGGAGCGCGCGTGGTCTAATCAAATCATCA
FR/L7L10 CGGGGTACCCCATGACCGGAGCTAGCCGTCTGAGCGCGCTTGGTCGAATCAAATCATCA
FR/L7L12 CGGGGTACCCCATGACCGGAGCTAGCCGTCTGAGCGCGCGTGGTCTAATCAAATCATCA
Fhs10GCS90 CGGGGTACCCCATGGCTCGGGGCGAGCGGCGGCGCCGCGCAAA
FGCS(70-150) GGGGTACCCGGCTAGTTCGTCACGGG
FGCS(91-150) GGGGTACCCCTGCTCCGAAAGTCATG
  β1,2xylosyltransferase as template
FGCS13XYLT35 CGGGGTACCCCATGACCGGAGCTAGCCGTCGGAGCGCGCGTGGTCGAATCAGTAAACGGAATCCGAAG
FCNX11XYLT35 CGGGGTACCCCATGAATGATCGTAGACCGCAAAGGAAACGCCCAAGTAAACGGAATCCGAAG-3'
RXYLT35 GGACTAGTTGAAAACGACGATGAGTG
FXYLT35' GCTCTAGAGCATGAGTAAACGGAATCCG
RXYLT35' GGGGTACCTGAAAACGACGATGAGTG
  1. The BamHI, SpeI or KpnI restriction sites used for vector construction are underlined. Triplet codons for leucine or alanine are given in bold.