Skip to main content

Advertisement

Table 3 Information for six markers that were analyzed in the (Valmaine × Salinas 88) × Salinas mapping population with the HRM approach.

From: Association mapping and marker-assisted selection of the lettuce dieback resistance gene Tvr1

Marker EST/Contig in CGPDB Primer (5' - 3') Ta (°C) Mg (mM) Amplicon size (bp)
LK1457 QG_CA_Contig4638 F - AGGAGCAAAGGAAAGGCTTC 64 3 636-648
   R - TGCAACTTCTTCAGCCAATG    
Cntg4252 CLS_S3_Contig4252 F - AGAACCAGGTCGAATCATGG 61 1.5 208
   R - TTCTCGCCGTTGAGAAGAAT    
   Probe - AAGTGGCTATACAGCTTTGATCATAACGA    
Cntg10192 CLS_S3_Contig10192 F - CTCGTTTTCAACACCGACAA 61 1.5 185
   R - TAGGTGGGTCCGACTTTGAG    
CLSM9959 CLSM9959.b1_N18.ab1 F - TGCTCAATTACACTCGAACCA 61 1.5 326
   R - CTTCATGGAGAGAAATACAAGGTC    
CLSZ1525 CLSZ1525.b1_J22.ab1 F - GAAGAAACTCATGAATCTGCTCAA 62 3 157-158
   R - TTTGCTCAAGAACTCTTAAACCATT    
Cntg11275 CLS_S3_Contig11275 F - CCAAACCATAGGGACGAAAA 61 1.5 252-260
   R - GGAGGTATGTTGAGGTACATGAC    
  1. Marker Cntg4252 was analyzed in combination with a probe. Polymorphisms for three markers that are not shown in the table were detected by electrophoresis. All information for these is the same as in Table 2.