Skip to main content

Table 6 Primers designed to amplify wheat F3H for cloning, chromosomal localization and for expression analysis.

From: Relationship between homoeologous regulatory and structural genes in allopolyploid genome – A case study in bread wheat

Purpose Gene Gene segment specification (according Figure 1) or former gene name DNA/cDNA-derived PCR product length (bp) Forward primers Reverse primers
PCR-based cloning F3H Segment 1 variable atggcgccggtgagcaac tttacgtggcatggcatgcat
  F3H Segment 2 variable atgacgcgcctctctcgcg tggacggtgatccaggtcttg
  F3H Segment 3 variable [11] [11]
  F3H Segment 4 variable tctcgatcgatcgaccaccaa ctaggcaagaatttcgttgaggg
  F3H Segment 5 variable ccggtgagcaacgagacgttc ggcaagaatttcgttgagggg
Chromosomal assignment and F3H-A1 T. aestivum F3H1 703/- gccacctgcaggtatacacgcat ccaccgcccgtagtccct
physical mapping F3H-B1 T. aestivum F3H3 333/- gcgtgctgtccgaggcgc cgatcgatcgattaaggatt
  F3H-B2 T. aestivum F3H4 255/155 gctgcctgccgaggacaagg aacgcccgtagtcccgtgcc
  F3H-D1 T. aestivum F3H2 225/- gccacctgcaggtacccacacat ccacctcccgtagtcccg
  F3H-G1 T. timopheevii F3H2 t 371/- acgactcatggggctgtca caattggtggtcgatcgatcag
qRT-PCR, RT-PCR F3H-A1 T. aestivum F3H1 800/186 atgacacgcctctctcgcg ccaccgcccgtagtccct
  F3H-B1 T. aestivum F3H3 830/183 tgacgcgcctctctcgcgag accgcccgtagtcccgtgct
  F3H-B2 T. aestivum F3H4 255/155 gctgcctgccgaggacaagg aacgcccgtagtcccgtgcc
  F3H-D1 T. aestivum F3H2 281/145 atcgtctccagccacctgcag cgctgtatcgctccaccacg