Skip to main content

Table 3 Details of the newly developed SSR primers

From: Development of new genomic microsatellite markers from robusta coffee (Coffea canephoraPierre ex A. Froehner) showing broad cross-species transferability and utility in genetic studies

Sl. No. Primer Id Primer sequence (F: Forward; R: reverse) Repeat unit Ta (°C) Amplicon (bp) GenBank accession No. Linkage group
1 CaM02 F: CGCCAGCCACAGCCACTTGC (AGG)7 50 224 EU526557 --
   R: GCGGGGGTAAGAAAGAGGCGAG      
2 CaM03 F: CGCGCTTGCTCCCTCTGTCTCT (AC)11 57 173 EU526558 CLG03
   R: TGGGGGAGGGGCGGTGTT      
3 CaM06 F: ACCCGATATTCAACCGACATGC (CT)7 50 278 EU526559 --
   R: CATGACTTGAGCGCTAATATTTGAT      
4 CaM08 F: CAGCTGAAGTGGTGAAAAACAAGAG (TC)8 50 202 EU526560  
   R: CGCTTTCTTGTTTTCTCCATTTCAG      --
5 CaM09 F: CAGGAAGAGAAGAAAGTGAAATTGAC (TC)8 50 137 EU526560  
   R: CGCTTTCTTGTTTTCTCCATTTC      
6 CaM11 F: GTCCCCGCTTAAATAATATACACACA (AC)8–15 bp-AC(6)(AT)6 50 285 EU526561 --
   R: ATAGGACGGAGGGAGTAATAGAATAAA      
7 CaM12 F: TTCGGGCTCACCTGGCAG (CAG)10 50 155 EU526562  
   R: CGCGGAAGCAGGACATGGATT      --
8 CaM13 F: CCTCGCCCTCAATCACCTCCTAG (AAAT)5 50 287 EU526563  
   R: GGCTCCCCAAGAATCCTCAACTC      --
9 CaM15 F: AGCCCTAGACGAGATGGATTCC (CAG)5 50 170 EU526564  
   R: CGGCTCCTTCTGCACTCCCATTT      
10 CaM16 F: AAGGCAGCTGAAGCGGGACAAA (TC)11 50 199 EU526565 CLG11
   R: TGGGGAGAGCTGCAGTTGGAGG      
11 CaM17 F: CGGGCGTTTCTTCTTTTGAGTTGC (GTC)6 50 212 EU526566 --
   R: TCACGGTTTCTCAAGTCGGGGATTTA      
12 CaM18 F: CCGACTTGGACTGATGCGAAATTGA (TC)9 57 181 EU526567 --
   R: AAAGCAAAAAACCAGAAAACACGAAGA      
13 CaM20 F: GAAACCGCTGAAATTCGGTA (TATGGG)3 57 217 EU526568 CLG16
   R: CCCTCTGATTTCTCCTTTCATC      
14 CaM21 F: GGGCTTACCGACCGCTCACAG (TC)8 57 161 EU526569 --
   R: CCGCTATTGTTGCTGCTATGGAGTTG      
15 CaM22 F: CCCCTCCTCCTCCTACTAGATGGTGGT (AT)15 57 113 EU526570 CLG02
   R: GGTCCAGGGTCCATCCATTCTTGA      
16 CaM23 F: TGCTTGTAAGGGAATTTCTGGTCAG (AATT)5 50 154 EU526571 --
   R: GTGCGAATGTGGAACCTTTTAAGTCA      
17 CaM24 F: GGATTCGACAAGGTTGGCAGAGC (CCT)5–87 bp-(CTG)6 57 193 EU526572 --
   R: TGCCGAAGAAGAGGGAGATAGTGATG      
18 CaM25 F: TCCATCTTCCTTCATTTCTGCTGCTAA (GA)9 57 186 EU526573 --
   R: CCTTCACCCCCTTTGCACTTCCTTA      
19 CaM26 F: CGTTGCCATTTCTTCCCTTCTTTCTTC (TG)7–21 bp-(GA)9 57 236 EU526574 --
   R: ACACCTTACCCCCTTATCGTTTAGAA      
20 CaM27 F: AAGAGTGTTTGGGATTGCATTTTTAT (TA)7(GT)14 55 178 EU526575 --
   R: CCGCGTAGGCTTTGTTTGG      
21 CaM30 F: TTGCCTTCCGGATTTTTGATTCA (CA)6(TA)5 50 222 EU526576 --
   R: AGTTCTAAGGCTGAGGCGGCTAAAG      
22 CaM31 F: ATCCACTGCTGTCACCTTTTGTTA (TAA)5 55 261 EU526577 --
   R: AGCAGTGTGTGTGTTAAAGAGGAGTT      
23 CaM32 F: CAGACAGACCAGAGAGAGACACCTAAC (TA)12 50 204 EU526577 CLG12
   R: CCCCCTCCAAAATAATTCAGAAAA      
24 CaM33 F: GCGCATTAGGCGTGGGAGAA (A)13–5 bp-(AG)18 55 240 EU526578 --
   R: CAGAGGTTGTCGGTCAGGTGGAGAA      
25 CaM34 F: CTCCAAATTATTAAGCACAACAAACAA (GA)10 55 202 EU526579 --
   R: ATCCGCCTCCAGGTCTTATCC      
26 CaM35 F: CGAGCTAGAATGGATGACTTGGTTGG (TGGAAG)5 55 203 EU526580 CLG04
   R: GTTGCTCGCACCCGCTTCC      
27 CaM36 F: TGGTTTTAGTTTGTTTATTTTGATGTGAT (TTA)7 55 185 EU526581 --
   R: CGAGCCCTCCCCTTGCA      
28 CaM38 F: GAAGCTGAAGCGGGAGGGTAGTAATT (G)13(GA)7 55 228 EU526582 --
   R: CCCATCCACCCAACCTTCATTTC      
29 CaM39 F: GAGCAGAGGGAGACGGTGTGGT (GA)12 50 196 EU526583 --
   R: CGCGCAACTCTTCGAACTCTAACC      
30 CaM40 F: TTGACACGAAACAGGAAATAAATATAG (CGA)8 55 238 EU526584 --
   R: CCCTTCCCCTCATAGCCCTTT      
31 CaM41 F: CATCGTCTCCATCGTTGCTCTATC (TAAA)5 55 242 EU526585 --
   R: CCCTCCCCCTCTTTCCTATCTAAT      
32 CaM42 F: TGGGTCAAGGATCCGTGTAAGAAAGA (CT)8 55 191 EU526586 CLG01
   R: CCCTCACCAGTTCCCGATGTCAG      
33 CaM43 F: CCTGACCGTGAACCTGACCGTGAC (CT)8 55 202 EU526587 --
   R: TCGGGACTTGTTTTGGTTTTTGGGT      
34 CaM44 F: TGCTCTTGCCCTCTTTCATCC   55 222 EU526588 CLG09
   R: TCCCGAAAAAGAAAATAAGATAAAGAG (CT)9     
35 CaM45 F: CGCGGCCAGTGAATTCGAGCTC (GT)8(GA)5 50 218 EU526589 --
   R: TCGCCATTTGGAGCTGCTGATTCA      
36 CaM46 F: TGGTGCGGTGTTTTTCAGTTTGGAGA (AT)9 (AC)12 55 222 EU526590 CLG11
   R: AACCACCCACGCCCACCAATTAAAT      
37 CaM49 F: CCGGTTAATACATTGGTCTTT (A)33 55 200 EU526591 --
   R: ATGACATTGTTGACTTTGCTATAA      
38 CaM52 F: TGCCACTCGGAGCTCACTTCA (CCG)6 55 160 EU526592 --
   R: GGCTGCCGAGGTTCCAATT      
39 CaM53 F: TTAGGTGTGAGGAGGGATGGGACTG (GGC)9 50 172 EU526593 --
   R: CCACAGACTCCTCGTTCGGCAATC      
40 CaM54 F: ACGGGTGAGTCGAAGGGGGAGCAGT (GGCAGA)4–22 bp-(GCA)9 50 185 EU526593 --
   R: CACGCCGGCCCACATCTCGAAA      
41 CaM55 F: ATGGGGGGTGTCGGTCTATGTGA (GA)4(G)4 (A)27 50 183 EU526594 --
   R: CGCAATTCGCTGTCACCTCCG      
42 CaM57 F: CGAACTCGAACTCAAGCTCAGA (TA)23 50 190 EU526595 --
   R: AAGGATATATACGGTAATTTTA      
43 CaM58 F: ACCCCCTCTCCCTCTCCATTTTTAC CAGA(CA)7 55 192 EU526596 --
   R: GCACGAGGATGGAGCAGAGCACT      
44 CaM59 F: AAGTGAGTGGTTGTGGCATTAAAT GATA(GA)8 50 229 EU526591 --
   R: TTCTTACAAAATCTCATCCCCTCAT      
  1. CaM: Canephora Microsatellite marker; '--': Unmapped; these were not polymorphic among parents of the tested mapping population; CLG: Combined Linkage Group (as per [13]). The amplicon size is based on the original clone of Sln-274 genomic library from which the marker was designed.