Skip to main content

Table 4 Expression of previously reported conserved and non-conserved miRNAs in rice.

From: Identification of novel and candidate miRNAs in rice by high throughput sequencing

miRNA miRNA sequence Frequency in the untreated library Frequency in the drought-stressed library Frequency in the salt-stressed library
Osa-miR156a-j UGACAGAAGAGAGUGAGCAC 565 302 436
Osa-miR164a, b, f UGGAGAAGCAGGGCACGUGCA 55 32 38
Osa-miR166a-d, f, n UCGGACCAGGCUUCAUUCCCC 23 12 27
Osa-miR168a UCGCUUGGUGCAGAUCGGGAC 1007 533 388
Osa-miR169b, c CAGCCAAGGAUGACUUGCCGG 916 230 285
Osa-miR169f, g UAGCCAAGGAUGACUUGCCUA 939 238 291
Osa-miR169h-m UAGCCAAGGAUGACUUGCCUG 943 242 294
Osa-miR169n, o UAGCCAAGAAUGACUUGCCUA 271 67 76
Osa-miR172a, d AGAAUCUUGAUGAUGCUGCAU 402 100 192