Skip to main content

Advertisement

Table 4 Expression of previously reported conserved and non-conserved miRNAs in rice.

From: Identification of novel and candidate miRNAs in rice by high throughput sequencing

miRNA miRNA sequence Frequency in the untreated library Frequency in the drought-stressed library Frequency in the salt-stressed library
Osa-miR156a-j UGACAGAAGAGAGUGAGCAC 565 302 436
Osa-miR156k UGACAGAAGAGAGAGAGCACA 9 0 9
Osa-miR156l CGACAGAAGAGAGUGAGCAUA 520 271 390
Osa-miR159a, b UUUGGAUUGAAGGGAGCUCUG 92 16 45
Osa-miR159c AUUGGAUUGAAGGGAGCUCCA 89 15 41
Osa-miR159d AUUGGAUUGAAGGGAGCUCCG 79 13 37
Osa-miR159f CUUGGAUUGAAGGGAGCUCUA 90 16 41
Osa-miR159e AUUGGAUUGAAGGGAGCUCCU 0 0 0
Osa-miR160a-d UGCCUGGCUCCCUGUAUGCCA 71 43 71
Osa-miR160e UGCCUGGCUCCCUGUAUGCCG 66 41 68
Osa-miR160f UGCCUGGCUCCCUGAAUGCCA 30 15 21
Osa-miR162a UCGAUAAACCUCUGCAUCCAG 6 0 1
Osa-miR162b UCGAUAAGCCUCUGCAUCCAG 3 0 1
Osa-miR164a, b, f UGGAGAAGCAGGGCACGUGCA 55 32 38
Osa-miR164c UGGAGAAGCAGGGUACGUGCA 12 13 20
Osa-miR164d UGGAGAAGCAGGGCACGUGCU 45 22 32
Osa-miR164e UGGAGAAGCAGGGCACGUGAG 38 22 34
Osa-miR166a-d, f, n UCGGACCAGGCUUCAUUCCCC 23 12 27
Osa-miR166e UCGAACCAGGCUUCAUUCCCC 14 5 17
Osa-miR166g, h UCGGACCAGGCUUCAUUCCUC 24 12 26
Osa-miR166i, j UCGGAUCAGGCUUCAUUCCUC 1 0 0
Osa-miR166k, l UCGGACCAGGCUUCAAUCCCU 5 6 4
Osa-miR166m UCGGACCAGGCUUCAUUCCCU 24 13 27
Osa-miR167a-c UGAAGCUGCCAGCAUGAUCUA 106 34 36
Osa-miR167d-j UGAAGCUGCCAGCAUGAUCUG 111 34 36
Osa-miR168a UCGCUUGGUGCAGAUCGGGAC 1007 533 388
Osa-miR169a CAGCCAAGGAUGACUUGCCGA 916 230 283
Osa-miR169b, c CAGCCAAGGAUGACUUGCCGG 916 230 285
Osa-miR169d UAGCCAAGGAUGAAUUGCCGG 8 1 0
Osa-miR169e UAGCCAAGGAUGACUUGCCGG 925 237 289
Osa-miR169f, g UAGCCAAGGAUGACUUGCCUA 939 238 291
Osa-miR169h-m UAGCCAAGGAUGACUUGCCUG 943 242 294
Osa-miR169n, o UAGCCAAGAAUGACUUGCCUA 271 67 76
Osa-miR169p UAGCCAAGGACAAACUUGCCGG 2 1 1
Osa-miR169q UAGCCAAGGAGACUGCCCAUG 28 11 3
Osa-miR171a UGAUUGAGCCGCGCCAAUAUC 16 4 7
Osa-miR171b-f UGAUUGAGCCGUGCCAAUAUC 82 28 52
Osa-miR171g GAGGUGAGCCGAGCCAAUAUC 1 1 0
Osa-miR171h GUGAGCCGAACCAAUAUCACU 0 2 0
Osa-miR171i GGAUUGAGCCGCGUCAAUAUC 8 0 2
Osa-miR172a, d AGAAUCUUGAUGAUGCUGCAU 402 100 192
Osa-miR172b GGAAUCUUGAUGAUGCUGCAU 377 94 179
Osa-miR172c UGAAUCUUGAUGAUGCUGCAC 377 94 177
Osa-miR319a, b UUGGACUGAAGGGUGCUCCC 23 3 5
Osa-miR390 AAGCUCAGGAGGGAUAGCGCC 55 30 33
Osa-miR393a-b UCCAAAGGGAUCGCAUUGAUCU 123 23 47
Osa-miR394 UUGGCAUUCUGUCCACCUCC 1 1 2
Osa-miR395a-t GUGAAGUGCUUGGGGGAACUC 1 0 2
Osa-miR395o AUGAAGUGUUUGGAGGAACUC 1 0 0
Osa-miR396a-c UUCCACAGCUUUCUUGAACUG 8 1 4
Osa-miR396d, e UCCACAGGCUUUCUUGAACUG 20 5 8
Osa-miR397a, b UUAUUGAGUGCAGCGUUGAUG 10 5 11
Osa-miR398a, b UGUGUUCUCAGGUCGCCCCUG 21 5 3
Osa-miR399e-g UGCCAAAGGAGAUUUGCCCAG 1 0 0
Osa-miR408 CUGCACUGCCUCUUCCCUGGC 0 0 1
Osa-miR435 UUAUCCGGUAUUGGAGUUGA 4 0 1
Osa-miR437 AAAGUUAGAGAAGUUUGACUU 4 2 0
Osa-miR439a-j UGUCGAACCGCGGUUGUUCGA 4 1 0
Osa-miR440 AGUGUCUCCUGAUGAUCGGGACAA 4 1 1
Osa-miR441a-c UACCAUCAAUAUAAAUGUGGGAAA 2 2 0
Osa-miR442 UGACGUGUAAAUUGCGAGACGAAU 6 0 0
Osa-miR444 UUGCUGCCUCAAGCUUGCUGC 3 0 1
Osa-miR445a-i UAAAUUAGUGUAUAAACAUCCGAU 4 0 0
Osa-miR446 CAUCAAUAUGAAUAUGGGAAAUGG 2 2 3
Osa-miR528 UGGAAGGGGCAUGCAGAGGAG 0 0 1
Osa-miR529 CUGUACCCUCUCUCUUCUUC 1 1 1
Osa-miR530 AGGUGCAGAGGCAGAUGCAAC 22 6 1
Osa-miR531 CUCGCCGGGGCUGCGUGCCGCCAU 3 1 4
Osa-miR535 UGACAACGAGAGAGAGCACGC 10 7 36
Osa-miR806a-h AUGUGCUAAAAAGUCAACGGUG 19 3 9
Osa-miR808 AUGAAUGUGGGAAAUGUAAGAA 3 1 0
Osa-miR809a-h UGAAUGUGAGAAAUGUUAGAAU 7 4 1
Osa-miR811a-c ACCGUUAGAUCGAGAAAUGGACGU 4 1 0
Osa-miR812a-e GACGGACGGUUAAACGUUGGAC 3 1 2
Osa-miR813 GGGUUAUGGAAUGGGUUUUACC 3 3 1
Osa-miR814a-c CACUUCAUAGUACAACGAAUCU 0 2 1
Osa-miR815a-c AAGGGGAUUGAGGAGAUUGGG 2 2 0
Osa-miR816 GUGACAUAUUUUACUACAAC 0 0 0
Osa-miR817 UCCAACUUGAGGCCCGAUUGA 0 0 0
Osa-miR818a-e AAUCCCUUAUAUUAUGGGACGG 21 5 3
Osa-miR819a-k UCAGGUUAUAAGACUUUCUAGC 1 2 0
Osa-miR820a-c CGGCCUCGUGGAUGGACCAGG 55 17 26