Skip to main content

Table 1 Newly identified miRNAs in rice.

From: Identification of novel and candidate miRNAs in rice by high throughput sequencing

miRNA_id miRNA sequence Length Location Number of loci in the rice genome Frequency in the untreated library Frequency in the drought-stressed library Frequency in the salt-stressed library
Osa-miR167a* AUCAUGCAUGACAGCCUCAUUU 22 intergenic 1 0 0 1
Osa-miR810b.2 AAGUGAUUUAAUUAUGCCGUU 21 intergenic 1 8 4 0
Osa-miR444c.1 UGCAGUUGUUGUCUCAAGCUU 21 antisense to coding gene 3 3 0 1
Osa-miR444c.2 UGUUGUCUCAAGCUUGCUGCC 21 antisense to coding gene 2 3 2 4
Osa-miR444d UUGUGGCUUUCUUGCAAGUUG 21 antisense to coding gene 1 1 0 0
Osa-miR444e UGCAGUUGCUGCCUCAAGCUU 21 antisense to coding gene 2 2 0 1
Osa-miR444f UGCAGUUGUUGCCUCAAGCUU 21 antisense to coding gene 1 3 0 1
Osa-miR1423 AGCGCCCAAGCGGUAGUUGUC 21 intergenic 1 2 0 1
Osa-miR1425 UAGGAUUCAAUCCUUGCUGCU 21 intergenic 1 8 0 5
Osa-miR1427 UGCGGAACCGUGCGGUGGCGC 21 intergenic 1 8 1 2
Osa-miR1428 CGUUUUGCAAAUUCGCAGGCC 21 intergenic 1 2 0 0
Osa-miR1429 GUUGCACGGGUUUGUAUGUUG 21 intergenic 1 1 0 0
Osa-miR1430 UGGUGAGCCUUCCUGGCUAAG 21 intergenic 1 5 2 4
Osa-miR1431 UUUGCGAGUUGGCCCGCUUGC 21 intergenic 1 4 3  
Osa-miR1432 AUCAGGAGAGAUGACACCGAC 21 intergenic 1 15 7 9
Osa-miR1435 UUUCUUAAGUCAAACUUUUU 20 intergenic 1 2 0 0
Osa-miR1436 ACAUUAUGGGACGGAGGGAGU 21 intergenic 20 77 24 0
Osa-miR1437 UCCGGCGCCGCACUAGGCACUG 22 intergenic 1 5 3 0
Osa-miR1438 AGGGUAAUUUUAUCAUUUUUA 22 intergenic 1 2 0 0
Osa-miR1439 UUUUGGAACGGAGUGAGUAUU 21 intergenic 1 0 0 2
Osa-miR1440 UGCUCAAAUACCACUCUCCU 20 intergenic 2 0 2 0
Osa-miR1441 ACCGGAUGUCGGAAAAGGUUU 21 intergenic 3 0 24 0
Osa-miR1442 AUUCAUAGUACUAGAUGUGU 20 intergenic 2 0 0 5