Skip to main content

Table 1 Name and sequence of the different primers used in this study

From: AtMRP6/AtABCC6, an ATP-Binding Cassette transporter gene expressed during early steps of seedling development and up-regulated by cadmium in Arabidopsis thaliana

Primer name Sequence [5'-3']
MR06NotStart AAATATGCGGCCGCTATAAAGTGAACATTTTGGTCAACACTCAGTTCCTGATGGA
MR06R-StopNot GACCAAGGTTGTGAATCTGATTATACACTTCTATTTACGCTTTT ATAACTAGAAGAAATATGCGGCCGCTATAAA
AtMRP6-GFP_A GCCCATGGTGCTGCATGGACTGACATGC
AtMRP6-GFP_C GCTCCTCGCCCTTGCTCACCATGCTTCTTTTGGATTTGGATTC
AtMRP6-GFP_B GAATCCAAATCCAAAAGAAGCATGGTGAGCAAGGGCGAGGAGC
Rev_fin_GFP+Not I ATAGTTTAGCGGCCGCTTTACTTGTACAGCTCGTCC
MR06F-2500-Sbf1 CCTGCAGGTCCTTATCGTCTTCATCC
MR06R-1-Xma CCCGGGCAGGAACTGAGTGTTGACC