Skip to main content

Advertisement

Table 2 Details of primers and amplicons for each of the 11 evaluated genes

From: Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process

Gene Symbol Oligo Sequence
Forward/Reverse
Arabidopsis targeted Exons Optimized
Primer Concentration
[μM]
Amplicon Length
(pb)/Tm
Efficiency
     cDNA* gDNA** Mean*** SD
GAPDH GGCTGCAATCAAGGAGGAA/AAATCAATCACACGGGAACTG 9th/10th
11th
0.2 207/78.1 N/A 0.913 0.027
EFα1 TACTGGTGGTTTTGAAGCTG/AACTTCCTTCACGATTTCATCATA 2nd
3rd
0.2 166/79.2 246/79.2 0.953 0.106
TBP GCTAAGAACGCTGGACCTAATG/TGGGTGTGCCTTTCTGAATG 4th
6th
0.6 184/76.1 N/A 0.959 0.044
RPL8 CCGAAGGAGCTGTTGTTTGTA/ACCTGACCAATCATAGCACGA 1st
2nd
0.2 184/79.3 N/A 0.902 0.026
APT CCATGAGGAAACCCAAGAAGT/CCTCCAGTCGCAATTAGATCAT 4th
5th
0.2 143/78.5 1150/75.2 0.887 0.024
DNAJ GAGCACACATTGAGCCTTGAC/CTTTGGTACATCGGCATTCC 5th
6th
0.2 158/79.6 570/76.80 0.880 0.028
TUA AGCTCATTAGCGGCAAAGAA/AGTACCCCCACCAACAGCA 2nd
3rd
0.2 163/77.0 254/78.60 0.973 0.106
TIP41 ATGGAGTTTTTGAGTCTTCTGC/GCTGCGTTTCTGGCTTAGG 6th/7th
8th
0.4 235/78.3 1157/80.2 0.941 0.053
SAND TTGCTTGGAGGAACAGACG/GCAAACAGAACCCCTGAATC 6th
7th
0.4 164/78.2 N/A 0.944 0.053
CAC CCTCCGTTGTGATGTAACTGG/ATTGGTGGAAAGTAACATCATCG 7th
8th
0.6 173/76.4 610/78.0 0.931 0.047
Expressed GCTAAGAACGCTGGACCTAATG/TGGGTGTGCCTTTCTGAATG 6th
7th
0.2 183/76.0 285/76.80 0.874 0.037
  1. * Predicted from tomato cDNA sequences; ** Estimated by agarose gel electrophoresis; *** Mean of 3 technical replicas; N/A = Non-amplification