Skip to main content

Advertisement

Table 2 Details of primers and amplicons for each of the 11 evaluated genes

From: Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process

Gene Symbol Oligo Sequence Forward/Reverse Arabidopsis targeted Exons Optimized Primer Concentration [μM] Amplicon Length (pb)/Tm Efficiency
     cDNA* gDNA** Mean*** SD
GAPDH GGCTGCAATCAAGGAGGAA/AAATCAATCACACGGGAACTG 9th/10th 11th 0.2 207/78.1 N/A 0.913 0.027
EFα1 TACTGGTGGTTTTGAAGCTG/AACTTCCTTCACGATTTCATCATA 2nd 3rd 0.2 166/79.2 246/79.2 0.953 0.106
TBP GCTAAGAACGCTGGACCTAATG/TGGGTGTGCCTTTCTGAATG 4th 6th 0.6 184/76.1 N/A 0.959 0.044
RPL8 CCGAAGGAGCTGTTGTTTGTA/ACCTGACCAATCATAGCACGA 1st 2nd 0.2 184/79.3 N/A 0.902 0.026
APT CCATGAGGAAACCCAAGAAGT/CCTCCAGTCGCAATTAGATCAT 4th 5th 0.2 143/78.5 1150/75.2 0.887 0.024
DNAJ GAGCACACATTGAGCCTTGAC/CTTTGGTACATCGGCATTCC 5th 6th 0.2 158/79.6 570/76.80 0.880 0.028
TUA AGCTCATTAGCGGCAAAGAA/AGTACCCCCACCAACAGCA 2nd 3rd 0.2 163/77.0 254/78.60 0.973 0.106
TIP41 ATGGAGTTTTTGAGTCTTCTGC/GCTGCGTTTCTGGCTTAGG 6th/7th 8th 0.4 235/78.3 1157/80.2 0.941 0.053
SAND TTGCTTGGAGGAACAGACG/GCAAACAGAACCCCTGAATC 6th 7th 0.4 164/78.2 N/A 0.944 0.053
CAC CCTCCGTTGTGATGTAACTGG/ATTGGTGGAAAGTAACATCATCG 7th 8th 0.6 173/76.4 610/78.0 0.931 0.047
Expressed GCTAAGAACGCTGGACCTAATG/TGGGTGTGCCTTTCTGAATG 6th 7th 0.2 183/76.0 285/76.80 0.874 0.037
  1. * Predicted from tomato cDNA sequences; ** Estimated by agarose gel electrophoresis; *** Mean of 3 technical replicas; N/A = Non-amplification