Skip to main content

Table 2 Primer sets used in quantitative real time (Q-PCR) analysis. Primer sets used and the product sizes obtained in addition to the acquisition temperatures are shown.

From: TaMSH7: A cereal mismatch repair gene that affects fertility in transgenic barley (Hordeum vulgare L.)

Primer Name Primer Sequence (5' → 3') Product Size Acquisition Temperature (°C)
GAPdH2-2HvF GTGAGGCTGGTGCTGATTACG 198 bp 82
GAPdH2-2HvR TGGTGCAGCTAGCATTTGAGAC   82
MSH7QF CGGATGAAGGGTCTATGGCGTC 164 bp 77
MSH7QR CAGGTGGCACGCATTATTGTAGA   77
MSH2QF AGACCAGACATCACAACATCGGAG 206 bp 77
MSH2QR GCCATCAAGACATTTACACCAACC   77
MSH6QF CATAATATTGGCACAGATTGGAG 161 bp 80
MSH6QR CTGACGAAAGCACGGAAGC   80