Skip to main content

Advertisement

Table 1 Summary information on allele sequences for 11 candidate genes obtained from the 20 diploid heterozygous L. perenne genotypes within the LTS

From: Nucleotide diversity and linkage disequilibrium in 11 expressed resistance candidate genes in Lolium perenne

Genes Homologues Fragment length (bp)a Sequenced (bp)b No. of haplotypes Primers for gene fragments (5' to 3')
EST1 NBS-LRR 949 949 27 F ctcggatccaacatggagga R tgttgtcttgccaataccgc
EST6 NBS-LRR 936 932 27 F gggaaagtccaaacttgacg R cgtaagaatgggtgaaaggt
EST7 NBS-LRR 1036 1036 19 F atagccttcctttggcaatc R ctggacaacgagttacacgg R
EST26 NBS-LRR 1140 507 + 523 14 F gctgcagctggctaacaaca R ccaaatgtgccagcaactgc
EST31 NBS-LRR 943 943 12 F agcacgccatcactgttcta R ctagggcatcaaccgactgt
EST45 NBS-LRR 1014 1056 23 F gagcagccttcctccaaact R caaggccacgagaactagca
EST13 EDR-1 2200 480 + 479 10 F aagcggaggattaagatggc R cacatattcacatgggacgc
EST24 MAP-1 1350 505 + 480 13 F tatatccgccaacttccccg R tcaatcatcacctgcccacc
EST28 PKPA 1145 509 + 510 10 F gagcaacaagactgaccatt R caatctggtttgttcttggc
EST39 PKPA 1500 502 + 475 15 F cacatcatcggattccacaa R atacatcccaatccacctgg
EST40 PRP-1 1085 1085 9 F agaaacaggaggcgacaagt R ggagtgatcgtccttttaca
  1. a Fragment length responds to largest PCR band among 20 genotypes.
  2. b Length of fragments sequenced for all 20 LTS genotypes.