Skip to main content

Table 5 Comparative analysis of EST-SSRs between the genotypes NV#20F1-30, NV#20F1-39, and F6.

From: Frequency, type, and distribution of EST-SSRs from three genotypes of Lolium perenne, and their conservation across orthologous sequences of Festuca arundinacea, Brachypodium distachyon, and Oryza sativa

  NV#20F1-30 NV#20F1-39 F6
  Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2
Contig 0576 n.d. n.d. n.d. n.d. (TC)6ccctcgagtcgagtcctcccggcgagtctct (GCG)5 (TC)4ccctcgagtcgagtcctcccggcgagtctct (GCG)7
Contig 0395 n.d. n.d. n.d. n.d. (GCC)5 (GCC)4
Contig 0850 n.d. n.d. n.d. n.d. (GAG)10 (GAG)9
Contig 1068 n.d. n.d. n.d. n.d. (AGC)4 (AGC)5
Contig 2174 n.d. n.d. n.d. n.d. (CGC)7 (CGC)9
Contig 2043 n.d. n.d. n.d. n.d. (TGC)6 (TGC)4
Contig 0538 n.d. n.d. n.d. n.d. (GGT)4 (GGT)3
Contig 2873 n.d. n.d. n.d. n.d. (CCT)5 (CCT)4
Contig 2944 n.d. n.d. n.d. n.d. (GGC)4 (GGC)3
Contig 0131 n.d. n.d. n.d. n.d. (GGC)4 (GGC)3
Contig 0656 n.d. n.d. n.d. n.d. (GA)11tggcgtcggcagcaacggcgacgc (CGG)4 (GA)8tagagatggcgtcggcagcagcggcgacgc(CGG)4
Contig 3185 n.d. n.d. n.d. n.d. (CGC)5 (CGC)4
Contig 2810 n.d. n.d. n.d. n.d. (CCT)4tccctctcctctccccct (CGC)6 (CCT)4tccctctcccctccccct (CGC)5
Contig 2542 n.d. n.d. n.d. n.d. (CTC)4 (CTC)6
Contig 1034 n.d. n.d. n.d. n.d. (CGC)4 (CGC)5
Contig 3128 n.d. n.d. (GA)10 (GA)9 n.d. n.d.
Contig 2765 (ATGC)4ctatgcatggatgtgtggaagctcctttgcatgtac(AT)6 (ATGC)4ctatgcatggatgtgtggaagctcctttgcatgtac(AT)8 n.d. n.d. n.d. n.d.
Contig 0720 (CTG)5 (CTG)4 n.d. n.d. n.d. n.d.
Contig 2888 (TGTA)7 n.d. (TGTA)5 n.d. n.d. n.d.
Contig 0855 (TA)8 n.d. (TA)7 n.d. n.d. n.d.
Contig 1520 (TGA)5 n.d. (TGA)6 (TGA)7 n.d. n.d.
Contig 0700 (ATG)5 n.d. (ATG)4 n.d. (ATG)5 n.d.
  1. n.d: No allelic sequence present in the EST collection.