Skip to main content

Table 2 List of computationally predicted Physcomitrella miRNAs using the micoHarvester program.

From: Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution

Name Sequence 5'→3' Length (nt) Homologs Precursor genomic Precursor EST Expression verified
miR156a UGACAGAAGAGAGUGAGCAC 20 ath, gma, mtr, osa, ptc, ppt, sbi, sof, zma 1 (gnl|ti|850661024) n.f. n.e.
miR160-1* UGCCUGGCUCCCUGUAUGCCA 21 ath, gma, mtr, osa, ptc, zma, sbi 1 (gnl|ti|1003375177) n.f. n.e.
miR160-2 CGCCUGGCUCCCUGUAUGCCA 21 ath, gma, mtr, osa, ptc, zma, sbi 1 (gnl|ti|893498247) n.f. n.e.
miR160-3 CGCCUGGCUCCCUGCAUGCCA 21 ath, gma, mtr, osa, ptc, zma, sbi 1 (gnl|ti|1023106236) n.f. n.e.
miR160-4 CGCCUGGCUCCCUGCAUGCCG 21 ath, gma, mtr, osa, ptc, zma, sbi 1 (gnl|ti|1003194173) n.f. n.e.
miR165 UCGGACCAGGCUUCAUUCCCCU 22 ath 1 (gnl|ti|1036028061) n.f. n.e.
miR166 UCGGACCAGGCUUCAUUCCCU 21 ath, gma, mtr, osa, ptc, zma, sbi 1 (gnl|ti|1006181867) n.f. n.e.
miR167 GGAAGCUGCCAGCAUGAUCCU 21 ath,gma,ptc,osa, sbi,sof,zma 1 (gnl|ti|1003199194) n.f. no
miR171-1* AGAUUGAGCCGCGCCAAUAUC 21 ath, mtr, osa, ptc, sbi, zma 1 (gnl|ti|1024468070) n.f. n.e.
miR171-2 UUGAGCCGGGCCAAUAUCACA 21 ath, mtr, osa, ptc, sbi, zma 1 (gnl|ti|998754788) n.f. n.e.
miR172 AGAGAUUCUUGAUGAUGCUGAC 22 ath, gma, osa, ptc, sbi, zma n.f. 1 (PR_miR172) no
miR319-1 UUGGACUGAAGGGAGCUCCA 20 ath, gma, mtr, ptc, ppt 1 (gnl|ti|862775458) n.f. n.e.
miR319-2 CUCGGACUGAAGGGAGCUCCC 21 ath, gma, mtr, ptc, ppt 1 (gnl|ti|997238281) n.f. n.e.
miR390-1 GAGCUCAGGAGGGAUAGCGCC 21 ath, ptc, ppt, osa n.f. 1 (PR_miR390-1) n.e.
miR390-2a AAGCUCAGGAGGGAUAGCGCC 21 ath, ptc, ppt, osa 2 (gnl|ti|866247913, gnl|ti|830400956) n.f. n.e.
miR395 CUGAAGCGUUUGGGGGAAAGG 21 ath,mtr,osa,ptc, sbi,zma 1 (gnl|ti|997006956) n.f. Yes (G)
miR408 CUGCACUGCAUCUUCCCUGUGC 22 ath, osa, ptc, sof, zma n.f. 1 (PR_miR408) Yes (G)
miR414 UCAUCCUCAUCAUCCUCGUCC 21 ath, osa 1 (gnl|ti|759459888) n.f. Yes (P)
miR418 ACAUGUGAUGAAGAACUGACA 21 ath, osa n.f. 1 (PR_miR418) no
miR419 UGAUGAAUGAUGACGAUGUAU 21 ath, osa n.f. 1 (PR_miR419) Yes (P/G)
miR473-1 CCUCUCCCUCAAAGGCUUCCA 21 ptc n.f. 1 (PR_miR473-1) n.e.
miR473-2 CCUCUCCCUCAAGGCUUCCA 20 ptc 1 (gnl|ti|1042068147) n.f. yes (P/G)
miR477 UUCUCCCUCAAAGGCUUCCAA 21 ptc n.f. 2 (PR1_miR477, PR2_miR477) yes (P/G)
miR533-1a GAGCUGGCCAGGCUGUGAGGG 21 ppt 1 (gnl|ti|1006116182) 1 (PR_miR533-1) n.e.
miR533-2 GAGCUGUCCAGGCUGUGAGGG 21 ppt 1 (gnl|ti|1017424894) n.f. n.e.
miR534-1a UAUGUCCAUUGCAGUUGCAUAC 22 ppt 1 (gnl|ti|890445342) 1 (PR_miR534-1) n.e.
miR534-2 UAUGUCCAUUACAGUUGCAUAC 22 ppt 1 (gnl|ti|1029229383) n.f. n.e.
miR535-1a UGACAACGAGAGAGAGCACGC 21 osa, ppt 1 (gnl|ti|1020618162) n.f. n.e.
miR535-2 UGACAUCGAGAGAGAGCACGC 21 osa,ppt 1 (gnl|ti|1005915069) n.f. n.e.
  1. a Identified previously in Physcomitrella [17, 46]. * Identical to a miRNA in other plant species. ath: Arabidopsis thaliana, gma: Glycine max, mtr: Medicago truncatula, osa: Oryza stiva, ptc: Populus trichocarpa, ppt: Physcomitrella patens, sbi: Sorghum bicolor, sof: Saccharum officinarum, zma: Zea mays. Underlined accession numbers of genomic sequences indicate an identity greater than 95% to the EST sequence. n.e.: not examined, n.f.: not found. Different miRNA families are separated by lines. P: expressed in protonema tissue, G: expresses in gametophore tissue.