Skip to main content

Table 1 List of Physcomitrella miRNAs identified by cloning.

From: Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution

Name Sequence 5'→3' Length (nt) Homolog to known miRNA Precursor genomic Precursor EST Expression verified
1–22 AUUGGGACUUGUGCUGGGAC 20   1 (gnl|ti|872730449) n.f. no
1–39 CGUUUCACGUCGGGUUCACC 20   1 (gnl|ti|713836555) n.f. no
1–50 UGGCUGAGUCGAAGGUUGUGC 21   1 (gnl|ti|859644225) n.f. yes (P/G)
1–63 UUGCUGUGCACUACUUAGUA 20   2 (gnl|ti|1012878547, gnl|ti|835906822) 1 (PR_1-63/3-14) yes (P/G)
2-1 GUAGCUUAGCGAGGUGUUGGUA 22   1 (gnl|ti|890552627) 1 (PR_2-1) yes (G)
2–28 CGCUGUCCAUUCUGAGCAUUG 21   1 (gnl|ti|1010151671) n.f. yes (P/G)
2–31a UGACAACGAGAGAGAGCACGC 21 miR535 (ppt, osa) 3 (gnl|ti|1003237208, gnl|ti|756805268, gnl|ti|872833603) n.f. n.e.
2–42 GUCAAUUUGGCCGAGUGGUUAAGGC 25   1 (gnl|ti|1000320159) n.f. n.e.
2–51 GAGCUUUCUUCGGUCCAAUA 20   1 (gnl|ti|859644225) n.f. yes (P)
2–86a CCUUAGAGUCGUAGGCCUCUG 21 miR1218 (ppt) 1 (gnl|ti|774610216) 1 (PR_2-86) n.e.
2–88a UGACAGAAGAGAGUGAGCAC 20 miR156 (ath, osa, zma, sbi, sof, gma, ptc, ppt) 2 (gnl|ti|850661024, gnl|ti|784299453) n.f. n.e.
3–5 UGAUCAAGUGGAAACUCAGCAAA 23   1 (gnl|ti|863031657) n.f. no
3–14 GCUAGGCAGUGCACAGCGAUA 21   1 (gnl|ti|1012878547) 1 (PR_1-63/3-14) yes (P/G)
3–60a UUCGUGCCAAGCUGUGUGCAAC 22 miR536 (ppt) 2 (gnl|ti|890625113, gnl|ti|869792930) 1 (PR_3-60) n.e.
3–62 AACUGAGAUACAUCGCAAUCG 21   1 (gnl|ti|1029072876) n.f. no
3–91 GCUGUGUUCUUGUACCUGGG 20   1 (gnl|ti|831706876) n.f. no
5–21 UCUUGUCAAUGUUUAGGGGC 20   2 (gnl|ti|891393071, gnl|ti|836345675) n.f. yes (P/G)
5–33a UUGAGGUGUUUCUACAGGCU 20 miR537 (ppt) 1 (gnl|ti|903313912) n.f. n.e.
4–12 GGUAAAGUGGCGGCUAGGUUA 21   1 (gnl|ti|890397681) n.f. no
4–34a CGUGGGACAGCAUAGAAUGCG 21 miR1212 (ppt, pj) 1 (gnl|ti|713871562) n.f. n.e.
4–66 ACGAAGGUCUGCAUCAUAGCCAA 23   2 (gnl|ti|1000325696, gnl|ti|816375179) 1 (PR_4-66) yes (P)
4–67b AUCGUGCCAAGCUUUGUGCUUU 22 miR536 (ppt) 1 (gnl|ti|713832028) n.f. n.e.
4–72b UUGAGCCGCGCCAAUAUCACA 21 miR171 (ath, zma, osa, ptc) 2 (gnl|ti|1023219413, gnl|ti|993696673) n.f. yes (P)
3–36 GCUACUUCGGCGGGACAAGAGA 22   1 (gnl|ti|1020603193) n.f. n.e.
2–70 GUUGGAAGCCUUCGUGGGA 19   n.f. 1 (PR_2-70) no
2–15b UGACAACGAGAGAGAGUACGCU 22 miR535 (ppt, osa) n.f. n.f. n.e.
3–40b UGACAGAAGAGAGUGAGCACAU 22 miR156 (ath, gma, mtr, osa ptc, sbi, sof, zma, ppt) n.f. n.f. n.e.
3–44c UCGGAAGCCUUUGUGGGAGAGGAA 24 miR477 (ptc) n.f. n.f. yes (P/G)
3–54b CUUGGACUGAAGGGAGCUUUUUUU 24 miR319 (ath, gma, ppt, ptc, sbi, sof, zma) n.f. n.f. yes (P/G)
3–79c UCAUCCAGGGAGCCAGACAGA 21 miR160 (ath, gma, mtr, ptc, osa, sbi, zma) n.f. n.f. no
  1. a Identical to previously identified miRNA. b Homologous to known miRNA family, but not identical to individual members of this family. c The reverse and complementary sequence of the miRNA shows similarity to known miRNAs. ath: Arabidopsis thaliana, gma: Glycine max, mtr: Medicago truncatula, osa: Oryza sativa, ptc: Populus trichocarpa, ppt: Physcomitrella patens, pj: Polytrichum juniperinum, sbi: Sorghum bicolor, sof: Saccharum officinarum, zma: Zea mays. Underlined accession numbers of genomic sequences indicate an identity > 95% to the EST sequence. n.e.: not examined, n.f.: not found. P: expressed in protonema tissue, G: expressed in gametophore tissue.