Skip to main content

Table 4 Primers used

From: Silencing of beta-carotene hydroxylase increases total carotenoid and beta-carotene levels in potato tubers

Primer name Sequence Use
AS-chy Up1 TAGAGCTCGGGATTACTTC AS-chy cloning
AS-chy Dw2 ATGGATCCTCCTTTTCCAA AS-chy cloning
AS-h Up GTTAAGGGAACTTCTCCAC PCR screening
Nos-test 2 CGCGTATTAAATGTATAATTG PCR screening
AS-h RT Up ACCCTCCATTTGCCACGAA Real-time assay
AS-h RT Dw TTATATGATAATCATCGCAAGACCG Real-time assay
Chy1 Up CTTGGCCCAAAACCCACTT Real-time assay
Chy1 Dw CCTCAAATTGAGGTTTCAGCTTCT Real-time assay
Chy2 Up TTTTGCTGTCTCGAAGAAAGCC Real-time assay
Chy2 Dw AGCCAACAGGCAGCTAAACTCT Real-time assay
Lut5 Up GTCTCAAGCAAGCAACTTCGTG Real-time assay
Lut5 Dw GATAAAAGGTCCATGTGAGCACTG Real-time assay
Nxs Up CTTGGAGGAGACTTCTTTGGTGA Real-time assay
Nxs Dw CGGAAGTGGTCCTCCCATAG Real-time assay
  1. Sequences of the primers used for cloning of the gene fragment, for PCR screening of the putative transgenic plants, and for Real Time RT-PCR quantitation of transcript levels. For further details, see Methods.