Skip to main content

Table 3 Primers used for RT-PCR and probe synthesis

From: PR genes of apple: identification and expression in response to elicitors and inoculation with Erwinia amylovora

Gene name Primer Sequence (5' → 3')
PR-1a gctcagccgtaatacaatcctctc
tacccccactactgcacctcact
PR-1b gtttgctgcgcccattag
ttgcactttgaaacaccacatc
PR-1c agcttattttgggcatcttcacc
gtagttttgccccatatcacacca
PR-2 cttcacagtcaccatcttcaaca
ggtgcaccagctttttcaa
PR-5 ggcaggcgcagttccaccag
gacatgtctccggcgtatca
PR-8 caaaaacggcaatgaaggaacc
ctggcgagctcatcatagaactgc
EF1α agaccaccaagtactactgcac
ccaccaatcttgtacacatcc