Skip to main content

Table 1 Sequence of oligonucleotides used either to prepare double stranded DNA for EMSA or for RT-PCR and PCR:

From: An ABRE-binding factor, OSBZ8, is highly expressed in salt tolerant cultivars than in salt sensitive cultivars of indica rice

Name Sequence Size Use
1. ABRE5 5'AGCTTGCCGGACACGTGGCGCTCTAG3' 26 mer Annealed with ABRE3 to form 1X ABRE used in EMSA as probe or competitor
2. ABRE3 5'CTAGAGCGCCACGTGTCCGGCAAGCT3' 26 mer ABRE probe in EMSA
3.4X ABRE 5'CCTCGAAAGCTTGCCACGTGGCGCCACGTGGCGCCACGTGGCGCCACGTGGATGACGCACAATCCCAC3' 68 mer Annealed with 17 LS and filled in by Klenow to form double stranded DNA used as competitor in EMSA
4.2X ABRC 5'GTCAGAAAGCTTGCCACGTGGCTGCAGTG CCATTGCCACCGGATCAGCCACGTGGCTCCA GTGCTTGCCACCGGATGACGCACAATCCCAC3' 92 mer Annealed with 17 LS and filled in by Klenow to form double stranded DNA and used as competitor in EMSA
5. 4X DRE 5'CCACTTGAAGCTTACTACCGACATGAGTTCACTACCGACATGAGTTCACTACCGACATGACGCACAATCCCAC3' 72 mer Annealed with 17 LS and filled in by Klenow to form double stranded DNA and used as competitor in EMSA.
6. 2X ERE 5'AGCAAGCTTTTTTATTCCCAACAATAGAAAGTCTTGTTTTATTCCCAACAATAGAAAGTCTT GATGACGCACAATCCCAC 3' 80 mer Annealed with 17 LS and filled in by Klenow to form double stranded DNA and used as competitor in EMSA
7. 17 LS 5'GTGGGATTGTGCGTCAT3' 17 mer Preparation of ds Competitor
8.OSBZ85 5'TGTAGATCTCAACAATGGGAAATGACGAAGCTGTAGTTACTCA3' 43 mer Amplification of OSBZ8 cDNA by RT-PCR
9.OSBZ83 5'GAGAGATCTTTACTTGAGGCTACAGCATCAGTCGC3' 36 mer Amplification of OSBZ8 cDNA by RT-PCR
10.OSBZ85A 5'GGCGTGGAAACTGGTGGAGCT3' 21 mer For sequencing of cDNA
11.OSBZ83A 5'CTTGAGAATTCTAAGCTCCACCAGTTTCCACGCC3' 34 mer Amplification of 5'end of OSBZ8
12. RAB5 5'CGACAAGCTTCACGCGCACAGTACAC ACACAT-3' 32 mer Amplification of Rab16A promoter and full length by PCR from genomic DNA
13. RAB3A 5'TAGAGCTCGGATCCTCTAGACTGCAGT CATGCTGTGGTGTGCAAGCAGG-3' 49 mer Amplification of Rab16A promoter by PCR from genomic DNA
14. RAB3B 5'ATAGAGCTCTGGATCCTCAGTGCTGGCCGGGCAGCTT3' 37 mer Amplification of Rab16A full length by PCR from genomic DNA