Skip to main content

Table 3 A list of 44 microsatellite markers identified in a total of 42 unigenes showing the motif of the repeat unit and the annotation of the unigenes as defined by best-matched Arabidopsis protein (BLASTX E-value < 1e-10).

From: An expressed sequence tag (EST) library from developing fruits of an Hawaiian endemic mint (Stenogyne rugosa, Lamiaceae): characterization and microsatellite markers

Unigene ID Repeat Arabidopsis proteome hit
260553 GGCGGCGGCGGCGG At3g19760.1 – eukaryotic translation initiation factor 4A/DEAD box RNA helicase, putative
260567 ACAACACAACACAACACAA no hit
260570 AGCAGCAGCAGCAGCAGCAG At4g16280.1 – flowering time control protein/FCA gamma (FCA)
260579 TGCTGCTGCTGCT At2g41900.1 – zinc finger (CCCH-type) family protein
260619 ATATATATATA At3g48860.2 – expressed protein
260625 GATGATGATGATG At4g16630.1 – DEAD/DEAH box helicase, putative (RH28)
260641 TCATCATCATCA no hit
260657 CTGCTGCTGCTGCTGCT no hit
260658 TCGTCGTCGTCG At5g27540.1 – GTP-binding protein-related
260658 GCCGCCGCCGCCG At5g27540.1 – GTP-binding protein-related
260664 TTATTATTATTAT At3g04770.1 – 40S ribosomal protein SA (RPSaB)
260670 ACCACCACCACC At2g26510.1 – xanthine/uracil permease family protein
260691 TATATATATATAT no hit
260708 AGAAGAAGAAGAAGAAGAA no hit
260711 TTCTTCTTCTTCTTC At2g38410.1 – VHS domain-containing protein/GAT domain-containing protein
260714 AAATAAATAAATAAA no hit
260715 TGCTTGCTTGCTT At1g73660.1 – protein kinase family protein
260720 ATACATACATACA At5g49720.1 – endo-1,4-beta-glucanase KORRIGAN (KOR)/cellulase (OR16pep)
260754 ATTATTATTATT At1g48600.1 – phosphoethanolamine N-methyltransferase 2, putative (NMT2)
260776 ATATATATATATATATATATATATATATATATATAT At5g08380.1 – alpha-galactosidase, putative
260779 CGACCCGACCCGAC no hit
260781 TTATTATTATTA no hit
260802 ACAACACAACACAACACAACACAACACAA no hit
260810 ATCATCATCATCA At5g56350.1 – pyruvate kinase, putative
260811 CTCTCTCTCTC At5g48150.2 – phytochrome A signal transduction 1 (PAT1)
260853 CCGCCGCCGCCG At5g13440.1 – ubiquinol-cytochrome C reductase iron-sulfur subunit
260883 CCTCCCCTCCCCTC At5g46250.1 – RNA recognition motif (RRM)-containing protein
260903 CACCACCACCAC At3g11400.1 – eukaryotic translation initiation factor 3G/eIF3g
260907 GCTGCTGCTGCT At5g17920.1 – 5-methyltetrahydropteroyltriglutamate – homocysteine methyltransferase
260915 CCAAACCAAACCAAACCAAACCAAA At3g12020.1 – kinesin motor protein-related
260925 GCAGCAGCAGCA At1g03880.1 – 12S seed storage protein (CRB)
260939 GCTGCTGCTGCTGC At1g80490.2 – WD-40 repeat family protein
260940 ACGAACGAACGAA no hit
260971 GGCGGCGGCGGC no hit
260986 AGAAGAAGAAGAAGAA At1g10040.1 – expressed protein
260996 GCTGCTGCTGCT At5g17920.1 – 5-ethyltetrahydropteroyltriglutamate – homocysteine methyltransferase
261018 ATTTTATTTTATTTT At3g29160.3 – Snf1-related protein kinase (KIN11)
261039 TTAATTAATTAATT At2g45190.1 – axial regulator YABBY1/AFO
261062 GCTGCTGCTGCTGCTGCTG At2g28000.1 – RuBisCO subunit binding-protein alpha subunit/CHAPERONIN-60ALPHA
261064 ATACATACATACA At4g23400.1 – major intrinsic family protein/MIP family protein
261094 GAGAGAGAGAG At1g48410.2 – argonaute protein (AGO1)
261109 ATTCATTCATTCAT At3g15880.1 – WD-40 repeat family protein
261109 ACCACCACCACC At3g15880.1 – WD-40 repeat family protein
261131 TAATATAATATAATA no hit