Skip to main content

Table 2 Characteristics of chickpea EST markers developed from EST root library with primer sequence, GenBank accession numbers, PCR optimized parameters including touch down amplification profile.

From: Development of ESTs from chickpea roots and their use in diversity analysis of the Cicergenus

Marker Primer Sequence (5'--3') Forward Primer Sequence (5'--3') Reverse GenBank accession numbers Touch -down profile (°C) PCR optimised reagents
      Primer (pmol) Mg++ (mM) dNTP (mM) Taq (u)
AGLC2 TGTCAGACTGAGCTGTGTATGAGA TTGCCCGTATGGTTATGTTAGGAA CK148953* 55–45 0.3 1.5 0.15 0.3
AGLC7 GACCCCCAAAAATGAAAAAGCA TTGCCCATACATTCTTCACCCAA CK148966 60–55 0.3 1.5 0.15 0.3
AGLC8 CAAACTCCTCAATAGCAGGCACA GCTGTATCGGAGAGTGGTCAGA CK149041* 55–45 0.3 1.5 0.15 0.3
AGLC9 ACTCCTGTAGTGGCATATCTTCGA TGGTCCATTTATGCCGCTGGTA CK148709 60–55 0.3 1.5 0.15 0.3
AGLC14 GCAGCAACTATTTACACTGGTA CTCTCTGGGAGAAAGCTCGGAA CK149086* 60-55 0.45 1.5 0.15 0.3
AGLC15 ACTGATCAAGGTCTCTTCTAGACA CCCAACAAACTGGACAAAGCAGA CK149086* 60-55 0.45 1.5 0.15 0.3
AGLC16 GAGTACTTGCCAACTAGCTTAGGA TTGGATATAACAGATGACGGGGAA CK149087* 60-55 0.3 1.5 0.15 0.3
AGLC19 GCATCCTTCCCACTTCTTTGCA GAATGGACTCGGATGTCTTAAGCA CK148924* 60-55 0.3 1.5 0.15 0.3
AGLC20 AATGGTGATTCGTCAGTCGCCTA CTGTCTGAAGAAAGTGAACGAA CK148978* 60-55 0.3 1.5 0.15 0.3
AGLC27 CAAATTTCTGTTCTTCCACCCCAA GGCGATCTTCGAGTCCATCGA CK148933 60-55 0.3 1.5 0.15 0.3
AGLC28 GCTAAACCTTAGAGCAATGACTCA CCTTGCTTGTGCCTTATCTTCCA CK148934 60-55 0.3 1.5 0.15 0.3
AGLC29 TCTTCAACACCTCCATCTAACCTA GACATGAAACCAAAGCATCACA CK148945* 60-55 0.3 1.5 0.15 0.3
AGLC34 CTTTACCAAAACCACCTTCACCAA TCTCTCTCTCTCTCTTCTGTTCCA CK149140* 60-55 0.5 1.5 0.15 0.3
AGLC39 GCCGAGGTACACTTTACCAA TCCTCACACTTCAGGTTCAACGA CK149136 55-45 0.5 1.5 0.15 0.3
AGLC45 CTCCTCTTCTCCGTCGTAGCA CTGGTCCTTGACGGGAGTGA CK149070* 65-60 0.5 1.5 0.15 0.3
AGLC47 GTTTACATCATGACCCGCCCTA TCACCAAGACCAGAACGTTCCA CK148819 60-55 0.5 1.5 0.15 0.3
AGLC48 TGCCCAACGGTTTCTTTTACCA TCAGAGATACTCGCCCACCAA CK148960 55-45 0.5 1.5 0.15 0.3
AGLC51 TCTTTGAGCAGCATTCATTCCACA GAGTGCTACCTTCAAAGACTGCA CK148677 55-45 0.5 1.5 0.15 0.3
AGLC52 CGATCAAGAACCCAGTTTTGCAA AAGATCGACAGGCGATCTGGTA CK148718 55-45 0.5 1.5 0.15 0.3
AGLC53 CACTCTCCGTTCCGGTTCCA CTGTCCATGCCCTTGTCCA CK148806 60-55 0.3 1.5 0.2 0.5
AGLC55 CAGGTCGCGTTGTTGCA GGCCGAGGTACACTTTTCCA CK149133* 60-55 0.5 2 0.1 0.3
AGLC57 TTCATCTGGCACTAGCATATCTGA CGACAATTCTTGCTTCAACAACCA CK148900* 60-55 0.3 2 0.1 0.3
AGLC60 CATGTTTTCTACCCTCACAATGCA TACTCACTTGTTGTTCCAGACA CK149124* 55-45 0.2 1 0.1 0.2
AGLC61 TTCGATCCTCCGACCCCGAA TTCGCTAGATCTGGATACTTCTCA CK148802 60-55 0.3 2 0.1 0.3
AGLC64 TCTTCTTCTTCTTCTTCAGCCACA GTGGATTGGGAAATGTGAATGTCA CK149128* 55-45 0.2 1 0.1 0.2
AGLC66 CCACAAAGGACGACAACAACGA CCCAACACGAACCACACGA CK149070 60-55 0.2 2 0.2 0.5
AGLC67 ATCCATCACAACCCTCAACTCA CTCCGTCAACCTTTCCGCAA CK149102* 55-45 0.3 2 0.1 0.3
AGLC68 TGTTGTCTCGCCAATTCAAAGCA CGTTTGGTGGCATTCCTGCA CK148906* 55-45 0.3 2 0.1 0.3
AGLC72 TTTAATTACGCGGTTTCCACGA GAAGACTTGAGACATGGGCACA CK148928* 55-45 0.2 1 0.1 0.2
AGLC74 CGTGGGATTGAAAAAGTTGCTA CACTACCAGCCAAAGCACTCA CK149006* 55-45 0.2 1 0.1 0.2
AGLC75 CAACAACAACCTATCCGAACCTCA ACTATCCCTAACCTTCCATCACCA CK148853 60-55 0.5 1 0.2 0.5
AGLC76 CATGAGTGGTAGTGGGAGTGGA GTTCGTTTGAGTCGTTTACTGGAA CK148862 60-55 0.2 2 0.2 0.5
AGLC78 TCAACAACGCTACCCGATCCAA TTCTCAAGAGCACCACAAAAGAGA CK149132 60-55 0.3 2 0.1 0.3
AGLC79 CGGCGGCTATATTGGTTTTGCA TCCTAAACCCCACTTATCTCCCTA CK149080* 60-55 0.3 2 0.1 0.3
AGLC82 TTTGTGATGGTCCTGCTCTCTCA ACCGCTTCAGGATCAACTCGA CK148871 60-55 0.3 2 0.1 0.3
AGLC83 TCTTCCGATCCTAAGAAAGAGCAA ACCAATATGGAGAGCACCAGTCA CK148894 60-55 0.3 2 0.1 0.3
AGLC84 CCACCTTCCATCTCCAATTCCAA GACTGAATCGGAGAAGGTTTCTCA CK149089 60-55 0.15 2 0.1 0.2
AGLC85 CCAGCTTCTAATGTAGGTCTGCA CAGCAGCAGCAGAGAGAGCA CK148761 60-55 0.15 1 0.1 0.2
AGLC88 ACTTGGGCGTTCAAAAATCTCA CCATTACGATCAAAGAGCTCAGGA CK148768 55-45 0.3 2 0.1 0.3
AGLC93 GTCCGAGCTGTGGATAGGGAA GTTCCGCCTTCAATCCATGGAA CK148904* 60-55 0.2 2 0.2 0.5
AGLC94 CCAACTTCCCTCATTCTTATTCCA ACCAATTCCAAATTTCCAGCTCGA CK149093 55-45 0.2 1 0.1 0.2
AGLC96 TCCATATGGCTGAAGAACCCCAA TTCTGAGGTTCAGGTAGTTCGGAA CK149016* 60-55 0.2 2 0.2 0.5
AGLC98 CTCTTTCTTTCCCTCTAGTTTCCA CGGCGAACTCGTGTTTGCTA CK149016 55-45 0.2 1 0.1 0.2
AGLC101 TGTCCAAAATTGGGATCAGAGA AGAACGACTTCAGCAGCAGCA CK148993* 55-45 0.3 2 0.1 0.3
  1. *Genbank accession numbers of the longest EST sequence of the contig, used in primer design.