Skip to main content

Table 1 Primers for cDNA cloning of GGPP synthase.

From: Molecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohliiBriq

Primers Sequences (5' to 3') Designed from
A GGGGTACCYITTGYATHGCIGCITAYGA conserved sequence (LCIAACE)
B GGGGTACCGTIGARATGATHCAYACIAT conserved sequence (VEMIHTM)
C CGGGATCCTTIGTIACRTCIARDATRTC conserved sequence (DILDVTK)
D CGGGATCCARRTCYTTICCIGCIGTYTT conserved sequence (KTAGKDL)
E GACTCGTCTAGAGGATCCCGT adapter primer
F GACTCGTCTAGAGGATCCCGT17 oligo-dT adapter primer
G GGGGTACCCCTTATGGTTGGTGGGCTTC degenerated PCR product (KPTNHK)
H CGCCACGTTCTCGCCGTAGA degenerated PCR product (VYGENVA)
I CCATATTGGGTGGCGCCGAT degenerated PCR product (AILGGAD)
J GGGGTACCGATGAGGCGGTGGAGAAGCT degenerated PCR product (DEAVEKL)
K ATTTGGTGTTCGACGACGAC 5'RACE
L GGGGTACCCATATGAGCCTCATCGCGAGTC 5'RACE
M GCACGCGTCGACATTGTTCCGGTAAGCAAT 3'RACE
N AGTGAAATGGAAATTATTCA 3'RACE
O GGGGTACCGATGAGCCTCATCGCGAGTCCA 5'RACE
P GCACGCGTCGACAACAATGAGCCTCATCGCG N-terminal sequence (MSLIAS)
Q CATGCCATGGGGTTCACCCGCTCTGCCTTCT N-terminal sequence (EKAERVN)
R TTCTTGGATTTATGAAAGACGAACAAC 18S rRNA
S AAGACCAACAATTGCAATGATCTATCC 18S rRNA