Skip to main content

Table 1 Primers used in this study.

From: Ds tagging of BRANCHED FLORETLESS 1 (BFL1) that mediates the transition from spikelet to floret meristem in rice (Oryza sativaL)

Primer Sequence Target
Ds5_112- ATCGGTTATACGATAACGGTC Ds5'
Ds3_1 ACCCGACCGGATCGTATCGGT Ds3'
Ds3_3 GTATTTATCCCGTTCGTTTTCGT Ds3'
Ds3_6587+ CCGTCCCGCAAGTTAAATATG Ds3'
AD2 NGTCGA(G/C)(A/T)GANA(A/T)GAA  
GPAInt TCCAAGTCCACAAGGAAAATTG Ds
GUS_313- TCACTTCCTGATTATTGACCCAC Ds
Ac_1931+ CAGCTCCAAAGACAAAGACAAC Ac
Ac_2382- TGCAGCAGCAATAACAGAGTC Ac
LW1125_For TGTGGAGGAGAAATTAGACAGG Ds insertion flank (P0625E02)
LW1125_Rev CAGTGTGAAATGTGTAGAAGGG Ds insertion flank (P0625E02)
OsBfl1_For GCACCAACTTCGTCTACACCCA BFL1 (P0625E02)
OsBfl1_Rev2 TGAATGGAGAGTAGGAGTCGGAGC BFL1 (P0625E02)
RSs1_F TGCCTTGATCGAAGCTGAC RSs1
RSs1_R AGCAAGGGGTAGAGGCTCTC RSs1