Skip to main content

Table 1 Polymerase Chain Reaction primers. Primers SM-2, SM-3 and VA-1, VA-9 were utilized in the generation of digoxigenin labeled probes for hybridization. Primers T-11 through T-42 were utilized to amplify subunit A transcripts based on the position of the poly A tail.

From: Multi site polyadenylation and transcriptional response to stress of a vacuolar type H+-ATPase subunit A gene in Arabidopsis thaliana

Primer 5' to 3' sequence Amplification product 5' nucleotide position in cDNA
SM-2 CCTGGTGCATTTGGTTGTGGAAA Subunit A cDNA (300 bp probe) 779
SM-3 CATCATACTAACATTGTAACCCAT Subunit A cDNA (300 bp probe) 1055
VA-1 TCTTCGAACACACAAGCCACTTT Subunit A cDNA (1700 bp probe) 274
VA-9 AGAGACCATGAATGAAACCCTCT Subunit A cDNA (1700 bp probe) 1959
T-11 TTTTTTTTTTACAAAATG Subunit A, 3' end transcript-1 2264
T-12 TGAGAGAGCAGCTGGAAT Subunit A, 3' end transcript-1 1702
T-21 TTTTTTTTTTATCCCCAA Subunit A, 3' end transcript-2 2227
T-22 TCAGAAGTTCGAAGACCC Subunit A, 3' end transcript-2 1789
T-31 TTTTTTTTTTGGAGATAA Subunit A, 3' transcript-3 2210
T-32 CTGGATTCCGTGCTTTGG Subunit A, 3' transcript-3 1866
T-41 TTTTTTTTTTCAAATCAA Subunit A, 3' transcript-4 2173
T-42 GGAGAAAGAGGGTTTCAT Subunit A, 3' transcript-4 1952